ID: 964027132

View in Genome Browser
Species Human (GRCh38)
Location 3:152088161-152088183
Sequence CAGGAAAAACAGCAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964027122_964027132 5 Left 964027122 3:152088133-152088155 CCCTGCTAATGTAATGTGCCTCC No data
Right 964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG No data
964027123_964027132 4 Left 964027123 3:152088134-152088156 CCTGCTAATGTAATGTGCCTCCT No data
Right 964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG No data
964027121_964027132 25 Left 964027121 3:152088113-152088135 CCACGGGAAGGAAAATTTGTCCC No data
Right 964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964027132 Original CRISPR CAGGAAAAACAGCAGGATGG GGG Intergenic
No off target data available for this crispr