ID: 964029760

View in Genome Browser
Species Human (GRCh38)
Location 3:152123978-152124000
Sequence TTTCTTTCTTTAATTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964029760_964029763 30 Left 964029760 3:152123978-152124000 CCCCAAAAAATTAAAGAAAGAAA No data
Right 964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964029760 Original CRISPR TTTCTTTCTTTAATTTTTTG GGG (reversed) Intergenic