ID: 964029762

View in Genome Browser
Species Human (GRCh38)
Location 3:152123980-152124002
Sequence ATTTTCTTTCTTTAATTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964029762_964029763 28 Left 964029762 3:152123980-152124002 CCAAAAAATTAAAGAAAGAAAAT No data
Right 964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG No data
964029762_964029766 30 Left 964029762 3:152123980-152124002 CCAAAAAATTAAAGAAAGAAAAT No data
Right 964029766 3:152124033-152124055 CATGACTTCAACTATAAATGGGG No data
964029762_964029765 29 Left 964029762 3:152123980-152124002 CCAAAAAATTAAAGAAAGAAAAT No data
Right 964029765 3:152124032-152124054 CCATGACTTCAACTATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964029762 Original CRISPR ATTTTCTTTCTTTAATTTTT TGG (reversed) Intergenic