ID: 964029763

View in Genome Browser
Species Human (GRCh38)
Location 3:152124031-152124053
Sequence GCCATGACTTCAACTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964029761_964029763 29 Left 964029761 3:152123979-152124001 CCCAAAAAATTAAAGAAAGAAAA No data
Right 964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG No data
964029760_964029763 30 Left 964029760 3:152123978-152124000 CCCCAAAAAATTAAAGAAAGAAA No data
Right 964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG No data
964029762_964029763 28 Left 964029762 3:152123980-152124002 CCAAAAAATTAAAGAAAGAAAAT No data
Right 964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964029763 Original CRISPR GCCATGACTTCAACTATAAA TGG Intergenic
No off target data available for this crispr