ID: 964029765

View in Genome Browser
Species Human (GRCh38)
Location 3:152124032-152124054
Sequence CCATGACTTCAACTATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964029762_964029765 29 Left 964029762 3:152123980-152124002 CCAAAAAATTAAAGAAAGAAAAT No data
Right 964029765 3:152124032-152124054 CCATGACTTCAACTATAAATGGG No data
964029761_964029765 30 Left 964029761 3:152123979-152124001 CCCAAAAAATTAAAGAAAGAAAA No data
Right 964029765 3:152124032-152124054 CCATGACTTCAACTATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964029765 Original CRISPR CCATGACTTCAACTATAAAT GGG Intergenic