ID: 964029765 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:152124032-152124054 |
Sequence | CCATGACTTCAACTATAAAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
964029762_964029765 | 29 | Left | 964029762 | 3:152123980-152124002 | CCAAAAAATTAAAGAAAGAAAAT | No data | ||
Right | 964029765 | 3:152124032-152124054 | CCATGACTTCAACTATAAATGGG | No data | ||||
964029761_964029765 | 30 | Left | 964029761 | 3:152123979-152124001 | CCCAAAAAATTAAAGAAAGAAAA | No data | ||
Right | 964029765 | 3:152124032-152124054 | CCATGACTTCAACTATAAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
964029765 | Original CRISPR | CCATGACTTCAACTATAAAT GGG | Intergenic | ||