ID: 964030345

View in Genome Browser
Species Human (GRCh38)
Location 3:152131250-152131272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964030336_964030345 24 Left 964030336 3:152131203-152131225 CCATGAATACACAAAGGCATACA No data
Right 964030345 3:152131250-152131272 CTCAAAAGGGGGAAATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr