ID: 964030548

View in Genome Browser
Species Human (GRCh38)
Location 3:152133985-152134007
Sequence ATAGAGGCTTTATTTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964030546_964030548 28 Left 964030546 3:152133934-152133956 CCAAGAAAAATGGAAGGATATGT No data
Right 964030548 3:152133985-152134007 ATAGAGGCTTTATTTGCAATAGG No data
964030545_964030548 29 Left 964030545 3:152133933-152133955 CCCAAGAAAAATGGAAGGATATG No data
Right 964030548 3:152133985-152134007 ATAGAGGCTTTATTTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964030548 Original CRISPR ATAGAGGCTTTATTTGCAAT AGG Intergenic
No off target data available for this crispr