ID: 964036866

View in Genome Browser
Species Human (GRCh38)
Location 3:152209592-152209614
Sequence GTAAGCACCTTCTCATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964036866_964036868 22 Left 964036866 3:152209592-152209614 CCTTGAGATGAGAAGGTGCTTAC No data
Right 964036868 3:152209637-152209659 AGCTTTTCAAAGCATCTGTCAGG No data
964036866_964036869 25 Left 964036866 3:152209592-152209614 CCTTGAGATGAGAAGGTGCTTAC No data
Right 964036869 3:152209640-152209662 TTTTCAAAGCATCTGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964036866 Original CRISPR GTAAGCACCTTCTCATCTCA AGG (reversed) Intergenic
No off target data available for this crispr