ID: 964037205

View in Genome Browser
Species Human (GRCh38)
Location 3:152213979-152214001
Sequence GTGAAATTGCTCACTAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964037199_964037205 6 Left 964037199 3:152213950-152213972 CCTGGTAGAAACCTTCTCAGCCA No data
Right 964037205 3:152213979-152214001 GTGAAATTGCTCACTAACTGGGG No data
964037201_964037205 -5 Left 964037201 3:152213961-152213983 CCTTCTCAGCCAGGAAGAGTGAA No data
Right 964037205 3:152213979-152214001 GTGAAATTGCTCACTAACTGGGG No data
964037198_964037205 11 Left 964037198 3:152213945-152213967 CCTATCCTGGTAGAAACCTTCTC No data
Right 964037205 3:152213979-152214001 GTGAAATTGCTCACTAACTGGGG No data
964037196_964037205 25 Left 964037196 3:152213931-152213953 CCTTTTTGTTTTCACCTATCCTG No data
Right 964037205 3:152213979-152214001 GTGAAATTGCTCACTAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964037205 Original CRISPR GTGAAATTGCTCACTAACTG GGG Intergenic