ID: 964037510

View in Genome Browser
Species Human (GRCh38)
Location 3:152217334-152217356
Sequence TCCAGTTGGCCTGCAAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964037510_964037519 3 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037519 3:152217360-152217382 CCAGGTGGGTGTGGGCTTGGCGG No data
964037510_964037517 0 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037517 3:152217357-152217379 GTTCCAGGTGGGTGTGGGCTTGG 0: 23
1: 170
2: 813
3: 586
4: 578
964037510_964037516 -5 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037516 3:152217352-152217374 CTGGAGTTCCAGGTGGGTGTGGG No data
964037510_964037522 25 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037522 3:152217382-152217404 GGCCCCACACTCGGAGCAGCTGG 0: 46
1: 263
2: 359
3: 415
4: 442
964037510_964037520 4 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037520 3:152217361-152217383 CAGGTGGGTGTGGGCTTGGCGGG No data
964037510_964037515 -6 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037515 3:152217351-152217373 ACTGGAGTTCCAGGTGGGTGTGG No data
964037510_964037521 16 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037521 3:152217373-152217395 GGCTTGGCGGGCCCCACACTCGG 0: 42
1: 311
2: 396
3: 316
4: 287
964037510_964037526 29 Left 964037510 3:152217334-152217356 CCTGCACTTGCAGGCCAACTGGA No data
Right 964037526 3:152217386-152217408 CCACACTCGGAGCAGCTGGCTGG 0: 10
1: 61
2: 234
3: 380
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964037510 Original CRISPR TCCAGTTGGCCTGCAAGTGC AGG (reversed) Intergenic
No off target data available for this crispr