ID: 964041732

View in Genome Browser
Species Human (GRCh38)
Location 3:152269142-152269164
Sequence TCAGCCACGGGCAGACCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964041732_964041740 12 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041740 3:152269177-152269199 GAGGAGGTGCTCGCCGGCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 143
964041732_964041742 22 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041742 3:152269187-152269209 TCGCCGGCCGCGGTTCTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 66
964041732_964041745 27 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041745 3:152269192-152269214 GGCCGCGGTTCTCCCGGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 84
964041732_964041739 6 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041739 3:152269171-152269193 AAGTGCGAGGAGGTGCTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 71
964041732_964041746 28 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041746 3:152269193-152269215 GCCGCGGTTCTCCCGGGCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 92
964041732_964041738 -4 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041738 3:152269161-152269183 CTGAAGGAGGAAGTGCGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 400
964041732_964041744 26 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041744 3:152269191-152269213 CGGCCGCGGTTCTCCCGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 106
964041732_964041741 21 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041741 3:152269186-152269208 CTCGCCGGCCGCGGTTCTCCCGG 0: 1
1: 0
2: 2
3: 2
4: 70
964041732_964041737 -7 Left 964041732 3:152269142-152269164 CCGGCGGGTCTGCCCGTGGCTGA 0: 1
1: 0
2: 1
3: 8
4: 94
Right 964041737 3:152269158-152269180 TGGCTGAAGGAGGAAGTGCGAGG 0: 1
1: 0
2: 5
3: 31
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964041732 Original CRISPR TCAGCCACGGGCAGACCCGC CGG (reversed) Intronic
901506150 1:9687393-9687415 TCAGCCACCGGAAGTCACGCCGG - Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
909104501 1:71391896-71391918 TCAGCCATGGCCAGAGCAGCTGG - Intergenic
909826030 1:80127840-80127862 TCAGCCATGGCCAGAGCAGCTGG + Intergenic
915352012 1:155232782-155232804 TCAGCAAGGGGCAGACACCCTGG + Intergenic
918304757 1:183235738-183235760 TGAGCCACGGGAGGACCCGTAGG - Intronic
922797024 1:228345296-228345318 TCAGTCATGGGCAGACCCGCGGG - Intronic
923831795 1:237566364-237566386 TCAGCCACTGTCAGACCAGCTGG - Intronic
1075662220 10:124205864-124205886 TCAGCCACGTGAAGACCCACAGG + Intergenic
1083184401 11:61008772-61008794 GCAGCCCCGGGCAGTCCCACAGG - Exonic
1087717482 11:101625277-101625299 TCAGCCAATGGCAGACCCCTTGG - Intronic
1092643060 12:10537862-10537884 TCAGCCACGGGTGGAGCAGCTGG + Intergenic
1100398731 12:94208526-94208548 TCAGCTACGGGGAGTCCCGGAGG - Intronic
1103821786 12:123704545-123704567 TGATCCAGGTGCAGACCCGCTGG + Exonic
1110318422 13:74135017-74135039 TCAGGCAGGGGCAGCCCCGCGGG + Intergenic
1116822793 14:49641772-49641794 TCAGCCAGGGGCAGCCATGCAGG - Intergenic
1122860384 14:104579859-104579881 TGAGCCTCGGGCAGAACTGCAGG - Exonic
1124625803 15:31306935-31306957 ACAGCCAGGGGCAGACCCCGAGG + Intergenic
1125505694 15:40266343-40266365 TCAGCCACAGGCAGGCCAGGTGG + Exonic
1128469157 15:67937506-67937528 TCAGCCAAGGGCAGTTCCCCTGG + Intergenic
1128568021 15:68714043-68714065 TCAGCCACGGGGAGGCCTGCTGG + Intronic
1129828294 15:78650172-78650194 ACAGTCACGGGCAGAACCCCAGG - Intronic
1132587926 16:714406-714428 GCAGCCACGGGCACCCCTGCAGG - Intronic
1132601464 16:774894-774916 TCAGCCGGGGGCAGCGCCGCAGG + Exonic
1132629626 16:910954-910976 TCAGCCACCGGAAGCCCCACAGG + Exonic
1132950955 16:2562274-2562296 CCAGCCACTGGCAGGCCCACAGG - Intronic
1132963394 16:2637896-2637918 CCAGCCACTGGCAGGCCCACAGG + Intergenic
1134281634 16:12822014-12822036 TCTGCCACGGGAAGACGTGCCGG - Intergenic
1134303595 16:13012841-13012863 TCAGCCACGGCCAGACAGGGAGG + Intronic
1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG + Intergenic
1139589161 16:67923842-67923864 TCAGCCAAGGGCTGACTGGCTGG - Intronic
1143247851 17:5500949-5500971 TCAGCCATGGGCAGGATCGCGGG + Intronic
1143452043 17:7042281-7042303 CCAGCCACCCGCAGACCAGCCGG + Exonic
1144538544 17:16115175-16115197 TCAGCCATGGCCAGAGCTGCTGG + Intronic
1149110238 17:53019510-53019532 TCAGCCACAGGTAGAGCAGCTGG + Intergenic
1150692414 17:67377672-67377694 TTAGCATCGGGCAGACCCGCCGG + Intronic
1152392283 17:80010017-80010039 ACAGCCACGGCCACAGCCGCGGG + Intronic
1160246298 18:77162842-77162864 TACGCCACGGGCAGACCTCCTGG + Intergenic
1161033918 19:2073368-2073390 TCGGGCACCGGGAGACCCGCGGG + Exonic
1161085778 19:2334238-2334260 ACAGCCACGGGCAGAGCCACGGG - Intronic
1162039990 19:7964962-7964984 TCAGCCAAGCGCAGCCCTGCAGG + Intronic
1163066541 19:14800732-14800754 TCAGCCACGAGCAGACAAGATGG + Intronic
1163338012 19:16686323-16686345 TCACCCTCCAGCAGACCCGCTGG + Exonic
1163675866 19:18655002-18655024 TCAGCCATGGGGAGACAGGCTGG + Intronic
1166067730 19:40369991-40370013 CCAGCCACAGGCGGACCTGCAGG + Exonic
1167510548 19:49893419-49893441 GCAGTCACGGGCAGACCCCTAGG - Intronic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
934940354 2:98497089-98497111 TCAGCCACGGCTAGAGCGGCTGG - Intronic
934975923 2:98802187-98802209 GCAGCCCCGATCAGACCCGCTGG - Intronic
938168795 2:129056852-129056874 GCAGCCACGGGCAGACTCTTGGG + Intergenic
944636806 2:201682567-201682589 TCAGCCACGGGAAGACTGCCAGG - Intronic
945636326 2:212356330-212356352 TCAGCCACAGGCAGAGCCAATGG + Intronic
945709462 2:213278030-213278052 TCAGCCACGGCTAGAGCAGCTGG - Intergenic
946014194 2:216590920-216590942 TCAGCCACGGTCATGCCCTCTGG + Intergenic
1170536823 20:17348941-17348963 TTAGCCAAGGGCAGAGCCACGGG - Intronic
1173012680 20:39196406-39196428 TCAGCCACAGGCAAACCTTCAGG - Intergenic
1173738295 20:45377426-45377448 TCAGCCAAGGGCCGGCCTGCTGG + Intronic
1174295086 20:49540093-49540115 TCAGCCATGGGCAGAGCAGAGGG + Intronic
1175891122 20:62316489-62316511 TCAGCCCCGGGGAGCCCTGCAGG - Intronic
1176164333 20:63664869-63664891 TCAGCCTGGGGCAGAGCCTCTGG + Intronic
1178328582 21:31665543-31665565 TCAGCCACGCTCTCACCCGCAGG - Intronic
1179516043 21:41907687-41907709 GCTGCCGCAGGCAGACCCGCTGG + Exonic
1181983118 22:26780478-26780500 TCAGCCAAGGGCAGACCAGGAGG + Intergenic
953849438 3:46454843-46454865 TCAGCCACGGGGAGAGGCCCAGG + Intronic
954130679 3:48559196-48559218 TCAGCCACGGGTAGACTTTCTGG - Intronic
959973398 3:112431901-112431923 TCAGCCACGGATAGAGCAGCTGG - Intergenic
962356313 3:134697391-134697413 TCAAGCAGGGGCAGACCCTCTGG + Intronic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
965968935 3:174529787-174529809 TCAGCCACGGCTAGAGCAGCAGG + Intronic
966200775 3:177358391-177358413 TCAGCCACAGCCAGACAGGCTGG - Intergenic
966595713 3:181723294-181723316 TCAGCCAGCGGCAGGGCCGCGGG - Intergenic
968879574 4:3292341-3292363 TCCGGGAGGGGCAGACCCGCTGG + Intergenic
969423159 4:7108874-7108896 GCAGCCAGGGCCAGACCAGCGGG - Intergenic
971754384 4:30688688-30688710 CCAGCCACAGGCAGAGCTGCAGG - Intergenic
978552504 4:109942605-109942627 TCAGCCACGGGCAGGTAAGCTGG - Intronic
993904919 5:93612130-93612152 CCAGCCACTGGCAGAGCCGTGGG + Intergenic
1000541861 5:162550439-162550461 ACAGGCACGGGCACACCAGCAGG + Intergenic
1001822449 5:174720879-174720901 TCAGAAGCAGGCAGACCCGCGGG - Intergenic
1002170621 5:177372181-177372203 CCTGCCATGGGCAGGCCCGCAGG + Exonic
1002843336 6:924430-924452 ACAGGCACGGGCAGGCCAGCAGG + Intergenic
1005831250 6:29672806-29672828 TCAGACACCAGCAGACCCACTGG - Exonic
1006635463 6:35458350-35458372 GCAGCCAGGTGCAGAGCCGCAGG - Exonic
1006644463 6:35506242-35506264 TGAGACACGGGCAGCCCGGCAGG + Intronic
1011607313 6:89117905-89117927 GCGGCCGCGGGCAGACCCGGAGG - Exonic
1011918981 6:92547544-92547566 TCAGCCACGGCCGGAGCAGCTGG - Intergenic
1014406977 6:121064588-121064610 TCAGCCATGGGTAGAGCAGCTGG - Intergenic
1020114711 7:5470131-5470153 TCAGCCTCGGGCAGTGACGCTGG + Intronic
1020459790 7:8416220-8416242 TCTGCCACAGTCAGACCTGCAGG + Intergenic
1022247398 7:28573510-28573532 TCAGCCATGAACACACCCGCTGG - Intronic
1023751654 7:43378840-43378862 TCAGGCAAGGGCAGAGCAGCAGG + Intronic
1023751743 7:43379561-43379583 TCAGGCAAGGGCAGAGCAGCAGG - Intronic
1030139020 7:106285695-106285717 TCAGCCATAGACAGAGCCGCCGG - Intronic
1034548792 7:151807261-151807283 TCAGCCACCAGCAGACCCATGGG + Intronic
1034979043 7:155464345-155464367 TCAGCCGTGGGCACACCCCCTGG - Exonic
1034991617 7:155551147-155551169 TGAGCCACGGGCACAGCGGCGGG - Intergenic
1035209023 7:157314153-157314175 GCAGCCGCGGGCAGAGCCACAGG - Intergenic
1048325465 8:133435813-133435835 TCTGCCACGGACAGTCACGCAGG + Intergenic
1049700300 8:144008096-144008118 TCAGCAACAGGCAGACCCGGAGG + Intronic
1055208449 9:73761831-73761853 TCAGGCACGGGCAGACACAGGGG + Intergenic
1060204681 9:121675522-121675544 TTAGCCAGAGGCAGACCCCCGGG - Intronic
1061422811 9:130481236-130481258 TCACACACTGGCAGACCCTCAGG - Intronic
1061870525 9:133517908-133517930 CCAGCCCCGGCCAGAGCCGCAGG - Intronic
1200827065 Y:7657238-7657260 TCAGCCGCGGGCAGACCATGCGG - Intergenic
1201489317 Y:14524261-14524283 TTAGGGACTGGCAGACCCGCAGG - Intronic