ID: 964041755

View in Genome Browser
Species Human (GRCh38)
Location 3:152269243-152269265
Sequence GTCCCTCAGCACCTCCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 447}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964041743_964041755 30 Left 964041743 3:152269190-152269212 CCGGCCGCGGTTCTCCCGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 97
Right 964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG 0: 1
1: 1
2: 5
3: 62
4: 447
964041754_964041755 0 Left 964041754 3:152269220-152269242 CCGCTCGCGGTAGTTGGTTTCGC 0: 1
1: 0
2: 0
3: 1
4: 6
Right 964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG 0: 1
1: 1
2: 5
3: 62
4: 447
964041750_964041755 16 Left 964041750 3:152269204-152269226 CCCGGGCAGGGGCGGGCCGCTCG 0: 1
1: 0
2: 5
3: 30
4: 300
Right 964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG 0: 1
1: 1
2: 5
3: 62
4: 447
964041747_964041755 26 Left 964041747 3:152269194-152269216 CCGCGGTTCTCCCGGGCAGGGGC 0: 1
1: 0
2: 1
3: 62
4: 869
Right 964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG 0: 1
1: 1
2: 5
3: 62
4: 447
964041751_964041755 15 Left 964041751 3:152269205-152269227 CCGGGCAGGGGCGGGCCGCTCGC 0: 1
1: 0
2: 1
3: 29
4: 206
Right 964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG 0: 1
1: 1
2: 5
3: 62
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964041755 Original CRISPR GTCCCTCAGCACCTCCTGCC CGG Intronic
900243316 1:1626914-1626936 GACCTTCAGCCCCTCCTGCCTGG + Exonic
900246279 1:1637571-1637593 GTCCCTCAGCAGCTGCACCCGGG - Intronic
900257506 1:1704713-1704735 GTCCCTCAGCATCTGCGCCCGGG - Intronic
900375267 1:2351367-2351389 GTCCCTGGGCTCCTCCTGCAGGG + Intronic
900413245 1:2523222-2523244 ATCCCAGGGCACCTCCTGCCTGG + Intronic
900420756 1:2555018-2555040 GGCCCTCAGCGCCCCCTGCCAGG - Intergenic
900573181 1:3369975-3369997 GTCACTGAGCTCCTCCAGCCCGG + Intronic
900607943 1:3532045-3532067 GTCCGTCACCACCTGCTGCAGGG - Intronic
900634801 1:3657774-3657796 CTCCCCCAGCACCTCCCGCCTGG + Intronic
901086244 1:6613923-6613945 GCCCCCCATCACCTCCAGCCCGG + Exonic
901807951 1:11749694-11749716 GTTCCTAAGCACGTGCTGCCTGG + Intronic
901844687 1:11974544-11974566 GGCCCTCAGCACTGCCTGCCTGG - Intronic
902241700 1:15094315-15094337 GGCCATCACCACCTCCAGCCAGG - Exonic
902410036 1:16207058-16207080 CTCCCCCAGCAGCTCCTTCCGGG - Exonic
902616655 1:17627322-17627344 GTTCTTCAGCATGTCCTGCCAGG - Exonic
903210313 1:21814594-21814616 GGCGCTCAACACCTCCTCCCCGG + Exonic
903296096 1:22343898-22343920 GTCGCCCATCACCTCCTCCCGGG - Intergenic
903919702 1:26790835-26790857 AAACCTCAGCACCTCCTTCCGGG - Exonic
904046987 1:27615000-27615022 GCCCCTCAGCCCCTCCCACCTGG + Intronic
904050831 1:27637290-27637312 GAACCTCAGCATCTTCTGCCTGG + Intergenic
904210621 1:28884761-28884783 GTCCCACAGCCCCTCCACCCAGG - Intergenic
904261557 1:29290585-29290607 GTCTCTCACCTCCTCCTCCCTGG + Intronic
904279344 1:29407899-29407921 ATCCATCATCACCTCCTGCAAGG - Intergenic
904292883 1:29498991-29499013 GTCTCTCACCTCCTCCTCCCTGG - Intergenic
904334007 1:29785306-29785328 GTCTCTCACCTCCTCCTCCCTGG - Intergenic
904344012 1:29856419-29856441 ACCCTTCAGCACCTCCTGCCTGG + Intergenic
904344602 1:29859706-29859728 ATCCCTCAGCATCTCCTGCCTGG - Intergenic
904396775 1:30227612-30227634 ATCCCTCAGCAGCTCCTGCCTGG + Intergenic
904412381 1:30332270-30332292 GTCTCTCACCTCCTCCTCCCTGG + Intergenic
904482932 1:30805441-30805463 CTGCCCCAGCACCTCCTTCCTGG - Intergenic
904586070 1:31581347-31581369 GTCCCTCATCACCTCTCACCTGG - Intronic
904681897 1:32234971-32234993 GGCACTGAGCACCACCTGCCTGG - Intergenic
904799450 1:33082226-33082248 GCCCGTCAGCTCCTCCTGCAAGG + Exonic
905512213 1:38530455-38530477 GTTGGTCAGCACCTGCTGCCTGG + Intergenic
905512228 1:38530540-38530562 GTTGGTCAGCACCTGCTGCCTGG + Intergenic
905899774 1:41573866-41573888 CTCCCTCTCCACCTCCTTCCAGG - Intronic
905921588 1:41722978-41723000 GACCCTCAGGATCTCCTACCTGG - Intronic
906055975 1:42917180-42917202 GTCCCCCAGCACTGCCGGCCTGG - Intergenic
906108660 1:43309205-43309227 GTCCCTCAGAACTTTCTGCAGGG + Intronic
906168038 1:43702532-43702554 GTCCCTAAGGACCTTCTCCCAGG + Intronic
906517911 1:46450459-46450481 TTCCCTCAGCCCTTCCAGCCTGG + Intergenic
906566188 1:46802835-46802857 GTGCCTCAGCATCACCTCCCTGG - Intronic
907445974 1:54507930-54507952 CTCCCTCAGCACCCCCACCCAGG - Intergenic
907569983 1:55474287-55474309 CTCTCACAGCAACTCCTGCCAGG + Intergenic
908136580 1:61139362-61139384 GCCCCTCAGCAAAGCCTGCCCGG - Intronic
908845798 1:68323150-68323172 GCCCCTCAGTTCCTCCTCCCAGG + Intergenic
911091714 1:94022516-94022538 GGCCCTTAGCCTCTCCTGCCTGG + Intronic
914722983 1:150304710-150304732 GTGCCACTGCAACTCCTGCCTGG + Intronic
915148598 1:153810804-153810826 GTGCCACTGCACCTCCAGCCTGG - Intronic
915551540 1:156638276-156638298 GCCCCCCACCCCCTCCTGCCTGG + Intergenic
916732618 1:167580193-167580215 GCCATTCAGCACCCCCTGCCTGG + Intergenic
916870979 1:168914312-168914334 CTCCCTCAGCACCCACTGCTGGG + Intergenic
917601128 1:176575059-176575081 GGCACTCATCACCTACTGCCTGG - Intronic
917633848 1:176916670-176916692 GACCCTCAGCAGCTCCCACCTGG + Intronic
918111561 1:181459329-181459351 TTCCCTCAGAGCCTGCTGCCTGG - Intronic
918125360 1:181579015-181579037 GTCCCTCAGCACCATCTGATAGG - Intronic
918315089 1:183316604-183316626 GTCCCTCAGGCCCCCGTGCCTGG - Intronic
918383646 1:183983719-183983741 GTGCCTCAGCTCCTCCTGAGGGG - Intronic
918945973 1:191065323-191065345 ATACTTCAGCACCTTCTGCCAGG - Intergenic
919733733 1:200931112-200931134 GGCCCCCAGCATCTCTTGCCTGG + Intergenic
919796957 1:201326686-201326708 GGCCCACACCACCTCCAGCCTGG - Intronic
920180935 1:204131361-204131383 GGCCCTCAGGCCCTCCTTCCAGG - Exonic
922610111 1:226920243-226920265 TTCCCTCCGCAGCTCCTGCAGGG + Intronic
922715715 1:227870146-227870168 TGCCCTGTGCACCTCCTGCCAGG - Intergenic
924440501 1:244081794-244081816 GTACCTCATTACCTCCTGCATGG + Intergenic
924513772 1:244749728-244749750 GTCTCTGTGCAGCTCCTGCCAGG + Intergenic
924669674 1:246110802-246110824 TTACCTCAGCCCATCCTGCCTGG + Intronic
924707909 1:246513238-246513260 CTCCCGGAGCACCTCCAGCCAGG - Intergenic
924952663 1:248898585-248898607 TTCCTTCAGGAGCTCCTGCCAGG - Intergenic
1063088710 10:2842354-2842376 GCCCCACAGCCTCTCCTGCCTGG + Intergenic
1064132509 10:12722401-12722423 GTGCCACTGCACCTCCAGCCTGG + Intronic
1064883674 10:20085402-20085424 GACCCTCAGCACCTCCCGCACGG - Intronic
1065140281 10:22713797-22713819 GGCCCCCAGCAGCTCCCGCCGGG + Intronic
1067061959 10:43082200-43082222 TTCCCACAGCTCCTCCTGGCTGG + Intronic
1067582290 10:47453216-47453238 GTCCTTCATCACCTACTGCATGG - Intergenic
1069695337 10:70381942-70381964 GTCCCCCAGCCCCGCGTGCCAGG + Intronic
1069902875 10:71715988-71716010 GTCCCTCGACAGCCCCTGCCGGG - Exonic
1071920122 10:90340369-90340391 TTACCTCAGCACCTCCTTCATGG - Intergenic
1072618370 10:97064274-97064296 GTCCCACATCATCTCCTGCTGGG - Intronic
1073431644 10:103491144-103491166 GTGCCCCAGCAACTCCTCCCTGG - Intergenic
1074913923 10:117937937-117937959 GTCCCTCATGTCCCCCTGCCCGG + Intergenic
1075015254 10:118905878-118905900 TTCCCCCACCACCTCCTGCCTGG - Intergenic
1075541687 10:123319007-123319029 GTCCCTTCACACCTCCAGCCAGG + Intergenic
1076368726 10:129938099-129938121 GTCCTTCAGCAGCACCTGGCAGG + Intronic
1076687917 10:132206445-132206467 GGCCCTCAGCATTTCCTTCCCGG + Intergenic
1076777134 10:132704135-132704157 GTGCCTCGACACCTCCTGTCTGG - Intronic
1076817201 10:132920800-132920822 GCCCCGCAGCACCTCCTGCTGGG + Intronic
1077159223 11:1105082-1105104 GCACCTCAGCCCCTCCAGCCTGG - Intergenic
1077218262 11:1404133-1404155 GGCACACAGCACCTCCAGCCTGG + Intronic
1077259154 11:1606494-1606516 ATCCCTCAGCATCTCCTGGAAGG - Intergenic
1077326677 11:1966999-1967021 GCCCCCCAGCACCTCCTCACTGG - Intronic
1077405147 11:2379345-2379367 CTCCCTCAGCCCCTACTCCCAGG - Intronic
1078375869 11:10792629-10792651 GTCCCACAGCGCCCTCTGCCGGG - Intergenic
1078663565 11:13306302-13306324 GGACTTCAGGACCTCCTGCCTGG - Intronic
1079101900 11:17547227-17547249 CTCCCTCAGCCCCTCCTCCCAGG - Intergenic
1079135056 11:17771700-17771722 CTCCATCACCACCTTCTGCCTGG + Exonic
1080679574 11:34461479-34461501 GCCCCGCAGGACCTCCTGCTTGG + Intronic
1083424835 11:62578131-62578153 GTCCCTTATCTCCTCCTGCCTGG - Intronic
1084006238 11:66325042-66325064 TTCCCTCCCCAACTCCTGCCTGG - Intergenic
1084274440 11:68044316-68044338 GTCCCGCAGGGCCTCCTGCAGGG - Exonic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1084428364 11:69097796-69097818 GGCCCTCTGCCCCTCCTGCGTGG + Intergenic
1084932894 11:72571078-72571100 GACCCTCACCACCTCCAGCGGGG + Intergenic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1086508151 11:87527748-87527770 GTACAGCAGCACCTTCTGCCTGG + Intergenic
1088987344 11:114921238-114921260 GCCCCTTTGCACATCCTGCCTGG + Intergenic
1089042631 11:115467606-115467628 GTCCCTCAGCCCCTCCTCAAAGG + Intronic
1089587548 11:119520001-119520023 TGCCCTCAGGACATCCTGCCCGG - Intergenic
1091321934 11:134657785-134657807 CTCCCCCAGCACCTCCAGCATGG - Intergenic
1202809658 11_KI270721v1_random:22179-22201 GCCCCCCAGCACCTCCTCACTGG - Intergenic
1091749753 12:3014936-3014958 GTCCCTCATGCCCTCCTGCGGGG + Intronic
1093660890 12:21755214-21755236 GGCCCTCATTACCTGCTGCCTGG - Intronic
1094119107 12:26950263-26950285 GTGCCACTGCACCTCCAGCCTGG - Intronic
1095181721 12:39154175-39154197 GTCCCTCAGCATGTACTACCTGG + Intergenic
1095958405 12:47819398-47819420 GTCCCTCGGCTCGTCCTCCCCGG + Intronic
1096560862 12:52434782-52434804 TTTTCTCAGCACCTACTGCCTGG + Intergenic
1096573560 12:52538999-52539021 TTCCCTCTGCACATCCTCCCAGG - Intergenic
1097221882 12:57455895-57455917 CTCCCTCTGCTGCTCCTGCCAGG - Intronic
1097264013 12:57735817-57735839 GTGTTTCAGCACCTCCTCCCAGG - Intronic
1097974419 12:65669208-65669230 GTCCCCCAGCACATCCTGCAGGG + Intergenic
1097993448 12:65861321-65861343 GTGCCACCGCACCTCCAGCCTGG + Intronic
1098336694 12:69412080-69412102 GACCCTCATCACCTCGTGTCTGG - Intergenic
1100750810 12:97696716-97696738 GTCACTCAGCCCCTCCTGGGAGG + Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1101603808 12:106233013-106233035 CTCCCTCCGCACCTCCCGGCAGG - Intergenic
1101687538 12:107040327-107040349 GTGCCACTGCACCTCCAGCCTGG - Intronic
1101944012 12:109122069-109122091 GTTCCTCTGCACATGCTGCCTGG - Intronic
1103083151 12:118041348-118041370 GTCTGTGAGCACCTGCTGCCTGG - Intronic
1103614950 12:122146015-122146037 TTCCCTCAACACCTGCTCCCCGG + Exonic
1104094089 12:125540683-125540705 GTCCACCAGCATCTCTTGCCTGG + Intronic
1104205081 12:126631200-126631222 GAACCACAGCATCTCCTGCCCGG - Intergenic
1104259567 12:127170493-127170515 GCCCCTCAACTCCTCCTGCGGGG + Intergenic
1104732992 12:131118900-131118922 GACCCTCAAGACCACCTGCCTGG - Intronic
1107206008 13:37789310-37789332 GGCACTTAGCAACTCCTGCCGGG + Intronic
1108245183 13:48506571-48506593 CTCCCTCAGCACTGCCAGCCGGG - Intronic
1108686989 13:52828215-52828237 GGCCCTCAGCACCTCTTCTCTGG + Intergenic
1109380053 13:61548155-61548177 GTGCCACTGCACCTCCAGCCTGG - Intergenic
1110625784 13:77654086-77654108 GTCCCTCAGAAACTCATGCAGGG - Intergenic
1111445260 13:88339303-88339325 TTACCTCAGCCTCTCCTGCCTGG - Intergenic
1113565174 13:111315558-111315580 CTCCCCCAGCCCCTCCTCCCTGG + Intergenic
1113593305 13:111515325-111515347 CTCCCTCAGACCCTCATGCCAGG - Intergenic
1113618362 13:111696646-111696668 GTTCCTCAGCACCACCTCCAAGG - Intergenic
1113623892 13:111781907-111781929 GTTCCTCAGCACCACCTCCAAGG - Intergenic
1113877040 13:113601176-113601198 GTCACCCAGCGTCTCCTGCCTGG + Intronic
1116192627 14:41679969-41679991 GGCCCTCAGCCACTACTGCCTGG - Intronic
1116457291 14:45134305-45134327 GTCCCTCAGCCGCACCAGCCCGG + Intronic
1117030285 14:51661888-51661910 GTCCCACTGCACATCCTACCAGG - Intronic
1117737052 14:58778106-58778128 CTCCTTCAGCACCTCCCTCCAGG + Intergenic
1117937201 14:60919742-60919764 GTCTCTCAGAAGTTCCTGCCAGG - Intronic
1118001140 14:61525043-61525065 TTTGGTCAGCACCTCCTGCCAGG + Intronic
1118818793 14:69331345-69331367 GGCACTCAGCACTTCCTGCAGGG - Intronic
1118853181 14:69600568-69600590 GTCCCACAGCACCTCAGCCCTGG + Intergenic
1120921571 14:89760487-89760509 GTCCATCATCATCTCCTCCCTGG - Intergenic
1121651503 14:95562331-95562353 GGGCCTCAGCAGCTACTGCCGGG - Intergenic
1121845574 14:97169464-97169486 GTCTCTGAGCACCTCCATCCCGG + Intergenic
1121901025 14:97693601-97693623 GTCCCTCCCCACCCCCCGCCAGG - Intergenic
1122207640 14:100156041-100156063 GTCCATCTCCAGCTCCTGCCGGG - Intronic
1122230441 14:100304196-100304218 GTACCCCAGCAGCCCCTGCCTGG - Intronic
1122542736 14:102507128-102507150 GTCGCCCAGCAGCTCCTGGCGGG + Exonic
1122557644 14:102590320-102590342 CTCCCACAGCCCCTTCTGCCTGG - Intergenic
1122690061 14:103528051-103528073 GTCACTCAGCCACTCCAGCCTGG - Intergenic
1123015059 14:105369538-105369560 TTCCCTCAGCACCCCCTCCCAGG - Intronic
1123056394 14:105572575-105572597 TGCCCTCACCACCTGCTGCCCGG - Intergenic
1123057537 14:105579232-105579254 TGCCCTCACCACCTGCTGCCCGG + Intergenic
1123080829 14:105692703-105692725 TGCCCTCACCACCTGCTGCCCGG - Intergenic
1123081814 14:105699165-105699187 TGCCCTCACCACCTGCTGCCCGG + Intergenic
1123117219 14:105900173-105900195 CTCACTCAGGACCTGCTGCCGGG - Intergenic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717560 15:23042347-23042369 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717584 15:23042419-23042441 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717663 15:23042682-23042704 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717750 15:23042979-23043001 GTCCCCCAGGACCTCTGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717878 15:23043390-23043412 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718302 15:23044869-23044891 GTCCCCCGGCACCTCTGGCCAGG - Intergenic
1123718347 15:23045048-23045070 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718477 15:23045488-23045510 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718560 15:23045758-23045780 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123718625 15:23046017-23046039 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718652 15:23046123-23046145 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718717 15:23046343-23046365 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719220 15:23048088-23048110 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719439 15:23048831-23048853 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1123719771 15:23050011-23050033 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719782 15:23050046-23050068 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719791 15:23050081-23050103 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719801 15:23050116-23050138 GTCCCCAAGCACCTCTGGCCAGG - Intergenic
1123719876 15:23050334-23050356 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719884 15:23050369-23050391 ATCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719903 15:23050439-23050461 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719924 15:23050509-23050531 GTCCCCCAGCACCTATGGCCAGG - Intergenic
1125598029 15:40899867-40899889 ATCCCGCAGCACCACCTGCCCGG - Exonic
1127344049 15:58076585-58076607 GTGCCACTGCACCTCCAGCCTGG + Intronic
1128698680 15:69788230-69788252 GCCCCTCATCATCACCTGCCTGG + Intergenic
1128804387 15:70519794-70519816 GTCCCTCAGTAGCTGGTGCCAGG - Intergenic
1130407171 15:83612454-83612476 GCCCCTCAGCACTTCCTGCTGGG + Intronic
1130743150 15:86622899-86622921 GTCTCTCATCACCTCCAGACGGG - Intronic
1131181235 15:90241437-90241459 CTCCCCCAGCGCCTGCTGCCGGG + Exonic
1131805383 15:96116550-96116572 GTGCCACTGCACCTCCAGCCAGG + Intergenic
1132618222 16:852683-852705 ATCCCACAGCCCCTCCTCCCGGG - Intergenic
1132677200 16:1125741-1125763 TCCACTCAGCACCTCCTGCTCGG + Intergenic
1132744845 16:1432297-1432319 GTCTCACAGCACCCCCTGGCCGG + Intergenic
1132844417 16:1993256-1993278 GTCCCTCAGCACCTGGCCCCAGG + Exonic
1133337079 16:5013228-5013250 GTCCCTGAGCACCTCCTGGCTGG - Intronic
1133615445 16:7472072-7472094 CTCCTTCAGCATATCCTGCCTGG + Intronic
1134103527 16:11469593-11469615 GTCCCTCAGCACTTCTGACCCGG + Exonic
1135040663 16:19114669-19114691 GTCCGGCAGCGCTTCCTGCCCGG + Exonic
1135921450 16:26652553-26652575 CTCCCTCATCACCTCCCACCAGG + Intergenic
1136550245 16:30979181-30979203 GTCCCCCAGAACCACCTGCTGGG + Exonic
1137044405 16:35642471-35642493 TGCCATCAGCACCTCCAGCCTGG - Intergenic
1137522253 16:49204377-49204399 GCACCTCCGCACCTCCTGTCTGG - Intergenic
1137605694 16:49785664-49785686 GGCCCTCAGCTCCTGCTGGCTGG - Intronic
1139939973 16:70598208-70598230 GCCCCCCAGAACTTCCTGCCAGG + Intronic
1139957843 16:70701555-70701577 GGCTGTCAGCATCTCCTGCCTGG + Intronic
1140112822 16:72018252-72018274 GTCCCTCTGAAACTCCTTCCAGG + Intronic
1141093754 16:81148320-81148342 GCCAATCATCACCTCCTGCCAGG + Intergenic
1141599799 16:85118777-85118799 CTCCCTCAGCCACTCCTGCAGGG + Intergenic
1142011018 16:87714192-87714214 GCCCCTCAGCAGCTCCTGATGGG - Intronic
1142130485 16:88429621-88429643 CTCCCTCAGCAGCGCCAGCCTGG + Exonic
1142181653 16:88674124-88674146 GTCCCTCAACACCTGTTTCCAGG + Intergenic
1142395363 16:89828618-89828640 GGCCTTCAGCACCTCCTCCAGGG - Exonic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1143563392 17:7708081-7708103 GGCCCTGAGCACCCCCTACCAGG - Exonic
1143585283 17:7847721-7847743 GCCCCCCACCACCCCCTGCCTGG + Exonic
1143594483 17:7906276-7906298 TTCCACCAGCTCCTCCTGCCAGG - Intronic
1144685175 17:17221445-17221467 CTCCCTCAGCGATTCCTGCCAGG + Intronic
1146633972 17:34490727-34490749 GTCCCTCAGGCCCTCATGCCTGG + Intergenic
1146676290 17:34775729-34775751 CTTCCCCAGCACCTCCTGGCAGG + Intergenic
1147337783 17:39737798-39737820 CTCCCTTGGCACCTGCTGCCAGG + Intergenic
1148072216 17:44915061-44915083 GTCCCTCTCAACCTCCAGCCGGG + Exonic
1148901654 17:50883184-50883206 GGCCATGAGCACCTCCTCCCTGG + Intergenic
1148909157 17:50931230-50931252 CTGCCCCTGCACCTCCTGCCCGG - Intergenic
1150218779 17:63484359-63484381 GTCCTTCAGCACCTCCTGCCAGG - Intergenic
1150595722 17:66602787-66602809 GTCCCTGAGAACCTCCAACCTGG + Intronic
1150648887 17:66997147-66997169 TTCCCTCAAAACCACCTGCCAGG - Intronic
1151513728 17:74578873-74578895 GGTCCTCAGTACCGCCTGCCTGG - Intergenic
1151887698 17:76932835-76932857 GTCCCGCATCTCCTCCTTCCAGG + Intronic
1151934844 17:77255354-77255376 GTCCCCCAGCTCCTCCTGCTGGG + Intergenic
1152145662 17:78567244-78567266 GCTCCCCAGCTCCTCCTGCCTGG - Intronic
1152350574 17:79781957-79781979 GTCTCTCAGCTTCTGCTGCCAGG + Intronic
1152935954 17:83136918-83136940 GTCCCTCAGGACCTTCCCCCGGG - Intergenic
1153472536 18:5463139-5463161 GGTTCTCAGCATCTCCTGCCTGG + Intronic
1156921658 18:42529730-42529752 GTCCCTCAGGACAACATGCCAGG + Intergenic
1157176766 18:45459175-45459197 GCCCTTCACCACCGCCTGCCAGG + Intronic
1157772212 18:50359024-50359046 ATCTTTCAGCACCTCCTGCTTGG - Intergenic
1157934448 18:51857889-51857911 CACCCTCCCCACCTCCTGCCAGG + Intergenic
1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG + Intronic
1160906306 19:1453239-1453261 GTGCTTCAGGACCTCCTGCAGGG - Exonic
1160949097 19:1657241-1657263 GTCCCTCAGCTTCCCCTGCCTGG - Intergenic
1161220235 19:3114991-3115013 GACCCGCAGCACGTCCTGCTGGG - Exonic
1161579974 19:5075346-5075368 GGGCCTCAGCAGCTGCTGCCGGG + Intronic
1161717035 19:5882102-5882124 GCCCCTCATCACCACCTCCCAGG + Intronic
1162152346 19:8655439-8655461 ATCCCACAGCACCTGCTCCCTGG + Intergenic
1162741840 19:12778066-12778088 GTCCCTCTGCAACCCCTCCCCGG + Intronic
1162976127 19:14207700-14207722 TTCCCTCCGCCCCTGCTGCCCGG - Intergenic
1163469006 19:17486216-17486238 ATCCCCCAGCACCTCCAGCCTGG - Intronic
1166803043 19:45469711-45469733 CTCCCTCTGCTCCTCATGCCCGG + Intronic
1167006711 19:46780926-46780948 GTGCCACTGCACCTCCAGCCTGG + Intronic
1167044600 19:47042346-47042368 GTCCCTCAGTGCCTCCTTCATGG - Intronic
1167461080 19:49625066-49625088 ATGCCTCAGCCCCTCCAGCCCGG - Intronic
1167577324 19:50324025-50324047 CTCCATCACCACCTTCTGCCTGG - Exonic
1167610729 19:50506649-50506671 GGCCCTCACCACCACCAGCCTGG - Intronic
1167881353 19:52461074-52461096 GTCCATCAGCAGCTCCAGCTAGG + Intronic
1168092563 19:54095582-54095604 GGCCCCCAGCCCCTCCTTCCTGG - Exonic
1168287915 19:55343512-55343534 CTCCCTCTTCCCCTCCTGCCTGG - Intronic
925190191 2:1876323-1876345 GTCTGTCAACACCTACTGCCTGG + Intronic
926232695 2:11016940-11016962 GCCCCTCAGAGCCTGCTGCCTGG - Intergenic
926242759 2:11101071-11101093 CTTCCTCAGCACCACCTGGCGGG - Intergenic
926327816 2:11800249-11800271 CTCCCTAAGCACCTGCTCCCTGG - Intronic
926910190 2:17845631-17845653 CTCCCTGAGCACCTCATGCTTGG + Intergenic
927583149 2:24273576-24273598 TTCCATCAACTCCTCCTGCCAGG + Intronic
927591304 2:24360349-24360371 GTCCCTCAGCACCGGCAGCCTGG + Exonic
927874705 2:26647612-26647634 GGCCCTCTGCACCCCCTCCCTGG - Intergenic
928290313 2:30030957-30030979 ATCCATCACCGCCTCCTGCCAGG + Intergenic
929587982 2:43127959-43127981 GTCCCTCTGCACTTTCTCCCAGG + Intergenic
930762087 2:55049230-55049252 CTCCCTCCTCACCTCCTGGCTGG - Intronic
931196005 2:60052853-60052875 GGTCCTCAGAACCTCCTCCCTGG - Intergenic
932329896 2:70892236-70892258 CTCCCTCTCCTCCTCCTGCCAGG - Intergenic
934039722 2:88117765-88117787 GGCCCCCAGCATCTCTTGCCTGG + Intergenic
934563568 2:95325472-95325494 GGCCCCCTGAACCTCCTGCCTGG - Intronic
934757059 2:96831850-96831872 CTCCCTCAGCTTCCCCTGCCCGG + Intronic
935653999 2:105406207-105406229 GACCTTCAGCATCTCCTGGCAGG + Intronic
936413983 2:112287642-112287664 GTGCCACTGCACCTCCAGCCTGG - Intronic
936517666 2:113192632-113192654 GCCCTTCAGCAGCTCCTCCCTGG - Intronic
937439083 2:121901871-121901893 GACCCTCATTACCTGCTGCCTGG - Intergenic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
939466369 2:142562052-142562074 GTCCCTCAGCACAGACAGCCTGG + Intergenic
946235633 2:218323097-218323119 CCCCCTCACCACCTCCAGCCGGG - Intronic
946335046 2:219030659-219030681 GTCCTGCCGCCCCTCCTGCCTGG + Intronic
946437248 2:219665453-219665475 GTCTCTCTGCCCCTCCTGGCTGG - Intergenic
947624610 2:231611868-231611890 CTCCCTCAGGACCTCCTTCTTGG - Intergenic
948050676 2:234977220-234977242 GACACTGGGCACCTCCTGCCGGG + Intronic
948127629 2:235576458-235576480 TTCCCCAAGCACCACCTGCCTGG - Intronic
948361182 2:237421734-237421756 GTTCCTCAGGGCTTCCTGCCAGG - Exonic
948420744 2:237858945-237858967 GGCCCTCACAACCTCCTGCCAGG + Intronic
948562095 2:238861024-238861046 TTCCCTTTGCACCTCCTCCCTGG - Intronic
948793848 2:240392293-240392315 CTCCTACAGCCCCTCCTGCCTGG + Intergenic
948863530 2:240764180-240764202 CCCCCTCAGCACCTCCTTGCTGG + Intronic
1168895308 20:1319843-1319865 GTCCCCCAGAACTTCCTCCCAGG - Intronic
1170122350 20:12924824-12924846 GTCCCTCAGAACCTACAGCCTGG - Intergenic
1170792843 20:19521830-19521852 GGCCTTCTGCACCTCCTGCCAGG - Intronic
1171253057 20:23664433-23664455 GTCCCTCAGTACCTCCTACCAGG + Intergenic
1171259544 20:23719747-23719769 GTCCCTCATTACCTCCTACCAGG + Intergenic
1171264719 20:23761644-23761666 GTCCCTCAGTACCTCATTCCAGG + Intergenic
1171399091 20:24860108-24860130 TGCCATCAGCACCCCCTGCCTGG + Intergenic
1171771681 20:29326898-29326920 GTCCCTCAGCCCCTCTTTCCCGG - Intergenic
1171823512 20:29875832-29875854 GTCCGTCAGCCCCTCTTTCCCGG + Intergenic
1171896583 20:30814514-30814536 GTCCGTCAGCCCCTCTTTCCCGG - Intergenic
1172033438 20:31996553-31996575 GTCCCGCAGCACCTTCTGGTAGG - Exonic
1172424664 20:34847253-34847275 GACCCTCATCATCTCTTGCCTGG + Intronic
1172511477 20:35504020-35504042 GTCTCCCAGCACCTCCTCCAGGG - Exonic
1172693196 20:36804406-36804428 CTCCCTCAGCCCCAACTGCCTGG - Intronic
1173524137 20:43719243-43719265 GGCCCCCAGCACCTCCTGAGTGG - Intergenic
1174412205 20:50343560-50343582 CTCCTTCAGAGCCTCCTGCCTGG - Intergenic
1174416870 20:50373193-50373215 CATCCTCAGCACCCCCTGCCCGG - Intergenic
1175517321 20:59577670-59577692 GTCCCCCAGCGCCTCGTGCCCGG - Intronic
1175540350 20:59744140-59744162 AACCCTCAGAACCTCCTGCTAGG + Intronic
1177129289 21:17236822-17236844 TGCCCTCAGGACCTCCTGTCTGG - Intergenic
1177866726 21:26521025-26521047 CTCCCTCCGCACCCCCTGACGGG - Intronic
1179440465 21:41390110-41390132 CTCGCTGAGCACCTGCTGCCTGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179521960 21:41951489-41951511 GTCTCTCCTGACCTCCTGCCTGG - Intronic
1179998637 21:44985241-44985263 GTCCCCGAGCACCTCCTGGCCGG - Intergenic
1181021850 22:20107682-20107704 CACCTTCAGCATCTCCTGCCTGG - Intronic
1181163281 22:20969961-20969983 GTGCATCAGCACCTGCTTCCTGG + Intronic
1181689220 22:24549094-24549116 GTCCCTGAGCAGCCCCTGCAGGG - Intronic
1182098415 22:27641426-27641448 AGCCCTCATCACCTCTTGCCTGG + Intergenic
1182270048 22:29147716-29147738 TGCCCTCAGCATCTCCTGGCTGG - Intronic
1182294964 22:29307165-29307187 GACCCCCAGCACTCCCTGCCTGG + Intronic
1182295329 22:29308743-29308765 GTCCCCCAGCACCAGGTGCCAGG + Intronic
1182468478 22:30532579-30532601 GTCCCTGAGCAACTCCTGTTTGG + Exonic
1182556688 22:31133159-31133181 GTACCTCACCACCGCCTGCTCGG - Exonic
1183234407 22:36606465-36606487 GTCACCTAGAACCTCCTGCCCGG - Intronic
1183271260 22:36863912-36863934 GTCTCTCAGCACCCCTTCCCAGG - Intronic
1184073786 22:42163312-42163334 GTTCCTCAGCACCTGCAGCCTGG + Intronic
1184286058 22:43472118-43472140 GACACTCAGCACTTCCTGACTGG + Intronic
1184901806 22:47450956-47450978 CTCCCTCATCACCTACTGGCTGG + Intergenic
1185052200 22:48559741-48559763 GCCCCGCCGCCCCTCCTGCCTGG - Intronic
1185136477 22:49076247-49076269 TTCCCTCACCACCTCCTGCGGGG - Intergenic
1185221780 22:49632691-49632713 GTGGCTCAGCGCCACCTGCCGGG + Intronic
1185321547 22:50202319-50202341 GTCCCTCAGCATCCCTTCCCCGG + Intronic
1185400665 22:50613892-50613914 GTCATGCAGCGCCTCCTGCCTGG - Intronic
1185414287 22:50701247-50701269 CTCCCACGGCACCTCCTGGCAGG + Intergenic
950012636 3:9733940-9733962 GGCCCTCATCACCTCTTGCCTGG - Intronic
950351314 3:12356521-12356543 ATTCCTCATCACCTCATGCCAGG + Intronic
950469028 3:13173374-13173396 GGACCTCAGCACCTGCAGCCCGG + Intergenic
950765431 3:15269725-15269747 GTGATTCAGCATCTCCTGCCAGG + Exonic
952445547 3:33377679-33377701 GCCCCTCTGGACCTGCTGCCAGG + Intronic
953502473 3:43451090-43451112 GTCCCTAAGCACATCCTTGCAGG + Intronic
953656990 3:44861994-44862016 TTCCCTCCGCACCTCCAGGCGGG + Exonic
955026314 3:55171168-55171190 GCTCCTCAGCACCTCCCACCTGG + Intergenic
955407405 3:58634093-58634115 CTCCCACAGCACATCCTACCCGG - Exonic
955543755 3:60005390-60005412 GGCCCCCAGCCCCTTCTGCCTGG + Intronic
956022291 3:64945607-64945629 ATCCTTCATCCCCTCCTGCCTGG - Intergenic
959516492 3:107272985-107273007 GTGCCACTGCACCTCCAGCCAGG - Intergenic
960120519 3:113944213-113944235 GTCCTTCAGTCCCTTCTGCCAGG - Intronic
960160933 3:114350228-114350250 CCCCCTCAGCCCCTGCTGCCAGG + Intronic
960589427 3:119351140-119351162 GTACCCCAGCACCTACTGCCTGG + Intronic
960968125 3:123119641-123119663 GTCACTCAACCCCTCCAGCCAGG - Intronic
961012849 3:123447915-123447937 GTCCCTGGGCGCCTGCTGCCTGG - Exonic
962180528 3:133201448-133201470 GCCCCCCACCACCTCCTGACAGG + Intronic
963140248 3:141940970-141940992 GTGCCATTGCACCTCCTGCCTGG + Intergenic
963939915 3:151087156-151087178 GTCGCCCAGCACCCCCAGCCTGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
964278558 3:155035770-155035792 GTCCCTCATCATCTGCTCCCCGG - Intronic
964705550 3:159615142-159615164 GTCCCTCTGTACCTTCTTCCTGG - Intronic
964812590 3:160681914-160681936 GTCCCTCAGTACCACCTACCGGG - Intergenic
967219125 3:187234608-187234630 GTCCCTCTGAACATCCTGCGGGG + Exonic
967843023 3:194022091-194022113 GTCCACCAGGACCTGCTGCCTGG + Intergenic
968672337 4:1858240-1858262 GGCAGTCACCACCTCCTGCCTGG - Intergenic
968927157 4:3555596-3555618 GTGGCCCAGCACCTCCTGGCCGG - Intergenic
969080203 4:4611993-4612015 GTCCTTTAGCTCCTGCTGCCTGG - Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
969347487 4:6578526-6578548 GTCCCTCAGGACCTCCAGTGGGG + Intronic
969381649 4:6803136-6803158 GTACCACTGCACCTCCAGCCTGG + Intronic
969507366 4:7596676-7596698 TTCCTTTAGCACCTCCTGGCAGG + Intronic
970207214 4:13666975-13666997 GGCCCTCAGCACTGGCTGCCTGG - Intergenic
970963340 4:21898640-21898662 GGCCCTCAGCAAGTACTGCCTGG - Intronic
974581754 4:63813010-63813032 TTCCCTCAGCATTTCTTGCCTGG + Intergenic
979840381 4:125432109-125432131 GGGCCTCTTCACCTCCTGCCTGG + Intronic
980093661 4:128467693-128467715 GGCCCTCTGGACCTCTTGCCTGG + Intergenic
980468463 4:133217959-133217981 GTACCACTGCACCTCCAGCCTGG + Intergenic
985445346 4:190018644-190018666 GTCCGTCAGCCCCTCTTTCCCGG + Intergenic
985607079 5:863532-863554 GCCCACCAGCACCTCCTGCAGGG - Intronic
985611362 5:891440-891462 GTTCCTCAGCAGACCCTGCCAGG - Intronic
985658163 5:1142729-1142751 GGCCGTGAGCACCTCCTGCCTGG - Intergenic
986202403 5:5590204-5590226 GTACCACTGCACCTCCAGCCTGG - Intergenic
987276674 5:16370511-16370533 GGCCCTCATCACTTCCTGTCAGG - Intergenic
992470347 5:77046001-77046023 GGCCCTCATCACATACTGCCTGG - Intronic
995263949 5:110137205-110137227 TTCCCTCAGGACCTCTTGCAAGG + Intergenic
995332036 5:110956788-110956810 GTCCCTCAGCACAAACAGCCTGG + Intergenic
997388794 5:133496744-133496766 GTCCCTTAGAACCTCCCTCCTGG - Intronic
997733027 5:136194325-136194347 TTCCCACTGCACCTCATGCCTGG + Intergenic
997779351 5:136641210-136641232 TCCCCTCAGCACCACCAGCCTGG + Intergenic
998168768 5:139859849-139859871 GTCACTCAGCACCATCTGCGTGG - Intronic
998367164 5:141638967-141638989 GTCCCCCAGCATCTCCTTCAAGG - Exonic
998430595 5:142066480-142066502 GTCCCTCAGCAAGTCCTGCTGGG - Intergenic
998467580 5:142357750-142357772 GTCCCTCACCACTTCCAGCCGGG + Intergenic
998476266 5:142424663-142424685 GCCCCTCAGTTACTCCTGCCAGG + Intergenic
998641354 5:144014853-144014875 GTGCCACTGCACCTCCAGCCTGG + Intergenic
999095063 5:148970343-148970365 GTCCCTCAGATCCCCCTGCAGGG + Intronic
1000245693 5:159446903-159446925 GTCCACCAGCAACTGCTGCCTGG - Intergenic
1002427477 5:179184830-179184852 GTCCCTCTCCGCCTCCTGGCAGG - Intronic
1003424049 6:5984790-5984812 TTCCCTCCTCACCTCCTGGCAGG - Intergenic
1007332380 6:41123069-41123091 TTGCTGCAGCACCTCCTGCCTGG + Intergenic
1007384341 6:41510526-41510548 CTCAAACAGCACCTCCTGCCCGG + Intergenic
1007622272 6:43222474-43222496 GTGGCGCAGCACCACCTGCCCGG - Intronic
1007633537 6:43285337-43285359 GGCCCTCCGCGCCTCCTGCCCGG - Exonic
1007727810 6:43927242-43927264 GTCCCTCAGCTCCACCCACCTGG + Intergenic
1007925659 6:45647516-45647538 GTCCCTAAGCAGGTGCTGCCTGG - Intronic
1010790681 6:80061277-80061299 GGCCCTCAGCAATACCTGCCAGG - Intergenic
1011746407 6:90411701-90411723 GTGCCTCAGCACCACAAGCCAGG - Intergenic
1013311866 6:108902006-108902028 CCCTCTCAGCACCTCCTGCCAGG + Intronic
1014391648 6:120872353-120872375 GTCCCTCAGCACCAACAGCGTGG + Intergenic
1016471152 6:144375881-144375903 GTCAATCAGCACGTTCTGCCTGG + Intronic
1017526401 6:155245000-155245022 GTCCAGCAGCACCTCCCGCCTGG + Intronic
1017777995 6:157694606-157694628 GTCCCTCAACACTTGCTGGCTGG - Intergenic
1018179617 6:161209827-161209849 GTTCTTCATCACATCCTGCCTGG - Intronic
1018390233 6:163336209-163336231 GTCCCCCAGCTCTGCCTGCCTGG + Intergenic
1019607500 7:1917474-1917496 CGCCCTCAGCACCGCCTGGCCGG + Intronic
1020517611 7:9142753-9142775 ATTCCTCAGCACCTTCTACCTGG - Intergenic
1020654575 7:10914119-10914141 CTTCCTCATCACCTGCTGCCTGG - Intergenic
1021841634 7:24726010-24726032 GCCTCCCAGCAGCTCCTGCCTGG - Intronic
1021970464 7:25960763-25960785 CTCCTTCAGCCCCTCTTGCCAGG + Intergenic
1022232582 7:28428512-28428534 ATCCCTCAGCAAGTCCTGCTAGG - Intronic
1022503783 7:30898131-30898153 GTGCCACTGCACCTCCAGCCTGG - Intergenic
1023054970 7:36283894-36283916 CTTCCTCAGCACCCGCTGCCTGG - Intronic
1023883660 7:44335612-44335634 CTCCCTCAGAGCCTCCTACCAGG + Intergenic
1024289344 7:47790371-47790393 GTGCCACTGCACCTCCAGCCTGG - Intronic
1024309210 7:47953693-47953715 TTCCCACAGCAGCTCCTACCTGG - Intronic
1024512582 7:50215321-50215343 TTCCCTCAGCAGCTCCAGCATGG - Intergenic
1024705032 7:51947650-51947672 GTGCCCCATCACCTGCTGCCAGG - Intergenic
1024869649 7:53948371-53948393 TTTCCTCATCACCTCCTGCTTGG + Intergenic
1025145405 7:56496783-56496805 GATCCTCAGCAGCCCCTGCCTGG - Intergenic
1025853909 7:65262447-65262469 GTCACTGAGCACATCCTGCCAGG + Intergenic
1025992377 7:66505679-66505701 GACCCGCAGCACGTCCTGCTGGG + Intergenic
1026964677 7:74431511-74431533 GTCCCTCTCCTCTTCCTGCCTGG - Intergenic
1030514099 7:110519536-110519558 ATCCCTTAGCACCCCCAGCCTGG - Intergenic
1032080234 7:128854980-128855002 GGCCCCAAGCATCTCCTGCCTGG - Intronic
1032921481 7:136553505-136553527 TTTGGTCAGCACCTCCTGCCTGG - Intergenic
1034479566 7:151309023-151309045 GTCCCTCTGCACCCGCTTCCAGG + Intergenic
1034989549 7:155539459-155539481 ATCCCCCTGCACCTCCTGGCTGG + Intergenic
1035238909 7:157517487-157517509 CTGCCTCTGCACCACCTGCCTGG - Intergenic
1036223020 8:6936812-6936834 GAGCCTCATCACCTCTTGCCTGG + Exonic
1036473587 8:9072903-9072925 TTCCTTCAGCAACACCTGCCGGG + Intronic
1037504297 8:19515222-19515244 GGTCCTCAGCACCTGCTGTCAGG + Intronic
1038207255 8:25478347-25478369 GGCCATCACCATCTCCTGCCTGG + Intronic
1038659636 8:29486126-29486148 CTCCATCACCAGCTCCTGCCAGG - Intergenic
1040809949 8:51440845-51440867 GGCCCTCTGCACCTCATGGCTGG - Intronic
1044525002 8:93241743-93241765 GCCCCTCAGCACCTACAGCCTGG - Intergenic
1046765485 8:118064893-118064915 GTCCCACTGCAACTCCAGCCTGG - Intronic
1046796814 8:118382276-118382298 GTGCCTCAGCAGCTCTTGCTAGG - Intronic
1048182202 8:132205922-132205944 GTCCCTCAGCTGCTCTTCCCTGG + Intronic
1049346034 8:142139145-142139167 GCCCCTCAGCACCTCCCTCGGGG + Intergenic
1049578871 8:143401800-143401822 GCCCCTCAGCACCCCCTTCCCGG + Intergenic
1049584378 8:143426108-143426130 ATCCCTCAGCTCCTCCTCACTGG - Intronic
1049744466 8:144257399-144257421 GGCCCCCAGCACCTCCTTCCTGG + Intronic
1050343410 9:4662857-4662879 GTTCATCAGCACCTCGCGCCCGG - Exonic
1053749219 9:41235827-41235849 GTCCGTCAGCCCCTCTTTCCCGG - Intergenic
1053802076 9:41770984-41771006 GTGGCCCAGCACCTCCTGGCCGG - Intergenic
1054143193 9:61544305-61544327 GTGGCCCAGCACCTCCTGGCCGG + Intergenic
1054190455 9:61982679-61982701 GTGGCCCAGCACCTCCTGGCCGG - Intergenic
1054254656 9:62800680-62800702 GTCCGTCAGCCCCTCTTTCCCGG - Intergenic
1054462901 9:65475186-65475208 GTGGCCCAGCACCTCCTGGCCGG + Intergenic
1055432397 9:76257543-76257565 GTCTCTCTGCACCTCCCACCAGG + Intronic
1055524607 9:77118101-77118123 TTCCCCCACCACCTACTGCCTGG - Intergenic
1056396556 9:86186756-86186778 GGCCCTGATCACCACCTGCCTGG + Intergenic
1057037871 9:91824834-91824856 GCCCGTCACCCCCTCCTGCCAGG - Intronic
1057299851 9:93871491-93871513 GTCCATGAGCCCCTCCTGCTGGG - Intergenic
1057782943 9:98064756-98064778 GTCCCTCAGCTGCTGCTGCCTGG + Intronic
1058418957 9:104817029-104817051 GGCCCTCAGCTCCTCATCCCTGG + Intronic
1058431698 9:104926606-104926628 GGCCCGCAGCGCCTCCTGGCCGG - Intronic
1058744496 9:107976701-107976723 AGTCCTCAGCATCTCCTGCCTGG - Intergenic
1059337450 9:113578159-113578181 GTCCATCAGGACCTGCTGCAGGG - Intronic
1059387319 9:113974733-113974755 GCCCCCCTGCACCCCCTGCCTGG + Intronic
1060220336 9:121761128-121761150 GTGCCTCAGCCCCACCTACCCGG + Intronic
1060814234 9:126626407-126626429 GTCCCTCTACTCGTCCTGCCCGG - Intronic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1062140639 9:134956060-134956082 CTGCCTCCTCACCTCCTGCCAGG - Intergenic
1062312547 9:135946804-135946826 ATCCCACGGCTCCTCCTGCCTGG - Intronic
1062359370 9:136180315-136180337 GACCCTCTGCACCCCCTCCCTGG + Intergenic
1062400509 9:136370582-136370604 CTCCCACAGCAGCTCCTGGCTGG + Exonic
1062591050 9:137274832-137274854 GTTCCTCAGCCCCTCCTCCCTGG - Intergenic
1062600460 9:137316685-137316707 GTCCCCCAGCCCCTGCAGCCCGG - Intronic
1203376581 Un_KI270442v1:382348-382370 GTCCGTCAGCCCCTCTTTCCCGG + Intergenic
1189308669 X:40005701-40005723 CTCCCTCCCCACCTCCGGCCCGG + Intergenic
1189794199 X:44631916-44631938 GTACCACTGCACCTCCAGCCTGG + Intergenic
1190221602 X:48515656-48515678 GTCCCCCAGCCCCTCCTGGAGGG - Intronic
1190952229 X:55157487-55157509 GTGCCACTGCACCTCCAGCCTGG + Intronic
1192245760 X:69370268-69370290 GTCTCTCAACGCCTCCAGCCTGG - Intergenic
1192439371 X:71163459-71163481 GTCCCTCTCCACTTCCTTCCGGG - Intronic
1192471363 X:71401750-71401772 GTCCCATAGCACTTCCTGCCTGG - Intronic
1192890967 X:75390069-75390091 GGCCCACAGCACCTACTGCCTGG - Intronic
1196007240 X:110849973-110849995 GCCCCTCAACACCTCTTCCCTGG + Intergenic
1197180682 X:123533157-123533179 TTTCCTCAGCACCTCTTGCAAGG + Intergenic
1197768509 X:130074301-130074323 GTCCCTCAGTACCTCTGGTCAGG - Intronic
1198400733 X:136265766-136265788 GTGCCACTGCACCTCCAGCCTGG - Intergenic
1199034220 X:143032284-143032306 GTCCCTCATGATCTCCTGCAAGG + Intronic