ID: 964041808

View in Genome Browser
Species Human (GRCh38)
Location 3:152269463-152269485
Sequence CCGCGCGCCGCTCGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 19}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964041808_964041814 5 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041814 3:152269491-152269513 CCCGGCGGCTCCCGCATCCCTGG 0: 1
1: 0
2: 0
3: 25
4: 304
964041808_964041816 11 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041816 3:152269497-152269519 GGCTCCCGCATCCCTGGCCCCGG 0: 1
1: 0
2: 3
3: 35
4: 361
964041808_964041812 -10 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041812 3:152269476-152269498 CGGCGCGCGGGTCTTCCCGGCGG 0: 1
1: 0
2: 1
3: 6
4: 62
964041808_964041817 12 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041817 3:152269498-152269520 GCTCCCGCATCCCTGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 438
964041808_964041825 29 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041825 3:152269515-152269537 CCCGGGGCTGCCATCCCGCCCGG 0: 1
1: 0
2: 3
3: 26
4: 275
964041808_964041818 13 Left 964041808 3:152269463-152269485 CCTCTGAGTCGAGCGGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 19
Right 964041818 3:152269499-152269521 CTCCCGCATCCCTGGCCCCGGGG 0: 1
1: 0
2: 4
3: 21
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964041808 Original CRISPR CCGCGCGCCGCTCGACTCAG AGG (reversed) Intronic
900184688 1:1327568-1327590 CGGCGCGGCGCACGACCCAGGGG - Exonic
910251159 1:85200796-85200818 CCCCGCCCCGGTCGCCTCAGAGG - Exonic
915238454 1:154502443-154502465 CCGCGCGCCCCTCCCCTCCGCGG + Intronic
922168278 1:223133895-223133917 CCGCGCCCCGCTCGACTCTCCGG - Intronic
1088311745 11:108467485-108467507 CCGGGCGCCGCTGGACTCCTAGG + Exonic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1097712919 12:62934848-62934870 CCGCGCGCGGCGCGTCCCAGTGG - Exonic
1135023811 16:18984039-18984061 CCGCGCCCCGCGCTCCTCAGAGG - Exonic
1139775043 16:69311588-69311610 CCGCCCGCCGCCCGGCTCTGCGG - Intronic
1140078500 16:71723503-71723525 CCGCGCGCCGCCCGCCTCGCAGG - Intronic
1151570625 17:74923749-74923771 CCGCGCTCCGTTGGACTCCGGGG - Intergenic
1159212616 18:65346037-65346059 CCGTGCCCCGCTCCACCCAGTGG - Intergenic
1161438859 19:4279469-4279491 TCGCGCTCCTCTCGGCTCAGCGG - Exonic
932566863 2:72916255-72916277 CCGTGCGCCGCGCAACTCTGCGG - Intronic
938934694 2:136117769-136117791 CCGCGCGCGGCGGGACTCAAGGG + Intronic
1181902789 22:26169685-26169707 CCGCCCGCCGCGGGACTCCGCGG + Exonic
953326140 3:42013798-42013820 CCGCGCGCGGCCCCACTCTGGGG - Intronic
953909025 3:46882606-46882628 CCCCGCGCCGCTCGGCTCGGTGG + Intronic
964041808 3:152269463-152269485 CCGCGCGCCGCTCGACTCAGAGG - Intronic
1037787660 8:21912209-21912231 CCGCACCCCGCGCGACTCACGGG + Exonic
1062430608 9:136525414-136525436 CCGGGCGCCGCTCTTCCCAGTGG + Intronic
1062446354 9:136596971-136596993 CAGGGCGCCGCTCGGCACAGGGG + Intergenic
1062596682 9:137302734-137302756 CCGCGCGCCTCTCCGCTCAGAGG - Intergenic