ID: 964045525

View in Genome Browser
Species Human (GRCh38)
Location 3:152320434-152320456
Sequence CAGCACATGGGGACCTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964045519_964045525 17 Left 964045519 3:152320394-152320416 CCTGGACTCATGCCATGTTTTGT 0: 1
1: 0
2: 2
3: 17
4: 188
Right 964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 85
964045518_964045525 18 Left 964045518 3:152320393-152320415 CCCTGGACTCATGCCATGTTTTG 0: 1
1: 0
2: 0
3: 21
4: 166
Right 964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 85
964045520_964045525 5 Left 964045520 3:152320406-152320428 CCATGTTTTGTATGTTATCTTGT 0: 1
1: 0
2: 1
3: 48
4: 595
Right 964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 85
964045517_964045525 23 Left 964045517 3:152320388-152320410 CCTTTCCCTGGACTCATGCCATG 0: 1
1: 0
2: 2
3: 27
4: 298
Right 964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964045525 Original CRISPR CAGCACATGGGGACCTAGTC AGG Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901344097 1:8523531-8523553 CAGCACATGGGAAGTTACTCTGG - Intronic
903658481 1:24963150-24963172 CTGCAGATGGGGACTGAGTCGGG - Intronic
904747549 1:32720396-32720418 GAGGAGATGGGGACCTAGTGAGG + Intergenic
909906927 1:81208631-81208653 CAGCACAAGGGCCCCAAGTCTGG + Intergenic
910098351 1:83549711-83549733 CAGCAAAAAGGGACCTAATCTGG - Intergenic
912899248 1:113630371-113630393 CAGCATTTCTGGACCTAGTCTGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
1063228108 10:4034907-4034929 CAGCACCTGGAGACCGGGTCTGG - Intergenic
1063879623 10:10517728-10517750 CAGCATCTGGGCACCTAGTGAGG - Intergenic
1063996859 10:11627709-11627731 CAGCACTTTGGGACCGAGGCGGG - Intergenic
1064358263 10:14639457-14639479 CAGCAAATGTGGGACTAGTCAGG + Intronic
1067459583 10:46447822-46447844 CAGCGCACTGGGACCTAGCCGGG + Intergenic
1067627605 10:47936791-47936813 CAGCGCACTGGGACCTAGCCGGG - Intergenic
1069790181 10:71014461-71014483 CAGCACAGGTGGAGCCAGTCTGG - Intergenic
1076420310 10:130326952-130326974 CAGCACATGTGGGACAAGTCTGG - Intergenic
1076732262 10:132444747-132444769 AAGTACCTGGGGACCTAGACGGG - Intronic
1076732618 10:132446188-132446210 AAGTACCTGGGGACCTAGACGGG + Intronic
1081868075 11:46370598-46370620 CAGCACATGGGGGTCTGGTCAGG + Intronic
1090094009 11:123725979-123726001 CCTCACATGGGGACCTAGCTAGG + Exonic
1091448568 12:558813-558835 CAGCCCAAGGGGACCTTGTCTGG - Intronic
1101797671 12:107990739-107990761 CAGGACATGGGGACTGAGTGAGG + Intergenic
1102306068 12:111805569-111805591 CAGCACTTTGGGACCAAGGCAGG - Intronic
1105889777 13:24674269-24674291 CAGCACAGGGGAACCCAGGCCGG + Intergenic
1116594845 14:46827966-46827988 GAGTACATGGTAACCTAGTCTGG + Intergenic
1118124755 14:62889362-62889384 CATCACATGGGGGCCAAGCCAGG + Intronic
1135864034 16:26084127-26084149 GAGCCCATGGGGACCTGGCCAGG - Intronic
1136500397 16:30667273-30667295 CAGTACATGAGGAGCCAGTCTGG - Intronic
1136501193 16:30670313-30670335 CAGGACCTGGGGACCTGGGCTGG + Exonic
1136568139 16:31081917-31081939 CAGCACGTGGGGGCGTGGTCAGG + Intronic
1139066100 16:63316824-63316846 CAGCACTTAGAGACCTAGGCAGG + Intergenic
1140063457 16:71590565-71590587 CAGACCATGGGGATCTACTCAGG - Intergenic
1140964992 16:79957275-79957297 AAGCTCATGGGAACTTAGTCTGG - Intergenic
1142196124 16:88740058-88740080 CGGCACGTGGGGCCCAAGTCAGG - Intronic
1148016088 17:44523675-44523697 CAGCACGTGGGGACCTCTCCTGG - Intergenic
1148326180 17:46784682-46784704 CATCTCGTGGGGACCTCGTCCGG - Intronic
1164630829 19:29760465-29760487 CAGAAAGTGGAGACCTAGTCAGG - Intergenic
1166240990 19:41493589-41493611 CAGCACATGGAGTCAGAGTCAGG + Intergenic
1168239132 19:55080560-55080582 CCGCCCATGGAGACCCAGTCCGG - Intronic
1168534878 19:57160553-57160575 CAGCACATGGGTACATAGTATGG + Intronic
930033946 2:47074170-47074192 CAGCTCTTGGGGAGCAAGTCTGG - Exonic
930978869 2:57497560-57497582 CAGCACATGTGGACATAGCCAGG - Intergenic
937167532 2:119835427-119835449 CAGCACTTCGGGACCGAGGCGGG - Intronic
941863991 2:170314424-170314446 CAGCACATGGCACCCTAGTATGG - Intronic
944668976 2:201979715-201979737 CAGCACTTTGGGACCGAGGCAGG - Intergenic
947876627 2:233471834-233471856 CACCACAAGGGGACCTGGGCCGG - Exonic
948347016 2:237307071-237307093 TAGCACATGGGGACCTGCTGTGG - Intergenic
948852240 2:240714161-240714183 CAGCACCTGGGGCCCTGGTGGGG - Exonic
948902450 2:240963427-240963449 AAGCGCATGGGGACCAAGTTGGG + Intronic
1170750762 20:19142673-19142695 CAGCAGATGGGAAGCAAGTCAGG - Intergenic
1171487753 20:25496429-25496451 CGGCCCATGGGGACGTAGCCAGG + Intronic
1178925809 21:36774119-36774141 CAACGCATGGGGACACAGTCAGG + Intronic
1181860181 22:25812272-25812294 CACCAGATGGGCACCTGGTCGGG - Intronic
1183777976 22:39980312-39980334 CAGAACCTGGGAACCTAGGCAGG + Intergenic
1184020428 22:41817483-41817505 CAGCACTTAGGGACCGAGGCAGG + Intronic
949358498 3:3206828-3206850 CAGCAGTTGGGGACAGAGTCAGG + Intergenic
950881953 3:16329309-16329331 CAGCACAAGTGGACCGAGACAGG + Intronic
952523552 3:34186226-34186248 CAGCACATGGGGACCAGGAAAGG - Intergenic
960267060 3:115632229-115632251 CATCACATGAGGGCCCAGTCAGG + Intronic
960987616 3:123290950-123290972 CAGCACCTGGGGACACGGTCAGG + Intronic
962364330 3:134767633-134767655 CTGCAGATGGGGTCCTAGTCTGG + Intronic
964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG + Intronic
967355482 3:188565109-188565131 CAGCTCCTGGGTATCTAGTCTGG + Intronic
968425939 4:523316-523338 CAGCACCTGGGCCCCTACTCTGG - Intronic
968491001 4:890448-890470 CAGCACATTGGGATGGAGTCTGG - Intronic
968674035 4:1867577-1867599 CAGCACTTTGGGACCAAGGCGGG - Intergenic
968974249 4:3812810-3812832 CAGCACATGCGGAACTTGTGTGG + Intergenic
974550347 4:63364094-63364116 CAGCACTTTGGGACCAAGGCAGG - Intergenic
984701207 4:182819782-182819804 TAGCACATTGGGACCTGGACAGG - Intergenic
985606416 5:860507-860529 CAGCACATGGGGACTGAGACTGG - Intronic
995454831 5:112340031-112340053 AACCACATGGGGCCCTAATCGGG - Intronic
996034859 5:118747339-118747361 CAGCACTTTGGGACCTAGGCTGG + Intergenic
1000312665 5:160060484-160060506 CAGGACATGTGGACATATTCAGG + Intronic
1002360249 5:178664694-178664716 GAGAACATGGGGACCAGGTCTGG - Intergenic
1017577393 6:155819995-155820017 GAGCACATGTGGACCCAGTGGGG + Intergenic
1018747551 6:166774113-166774135 CGGCACTTGGGGTCATAGTCTGG + Intronic
1019277697 7:184583-184605 CAGCACATGGGGGCTAGGTCCGG - Intergenic
1020463330 7:8448333-8448355 AAGCACATGGGAACCTGGTCCGG - Intronic
1021224847 7:18014825-18014847 AAGCACATGGGGACCTCAGCAGG + Intergenic
1027159895 7:75794703-75794725 CTACACATGGGGAGCTAGTGAGG + Intergenic
1029042914 7:97596725-97596747 CAGAAGATGGGGTTCTAGTCTGG + Intergenic
1035430986 7:158821642-158821664 CAGGTCATGGGGACCTGGGCTGG + Intronic
1035746387 8:1964398-1964420 CAGCATGTGGGGTCCTGGTCTGG + Intergenic
1038279707 8:26152861-26152883 CAGCATTTGGGGACCTACCCTGG - Intergenic
1039452944 8:37690278-37690300 CAGCTCCTGGGGAGCTAGGCCGG - Intergenic
1039709988 8:40046053-40046075 CAGCACTTGGGGGCCAAGGCGGG + Intergenic
1039883923 8:41644987-41645009 CAGCACCTGGGGACAGTGTCTGG + Intergenic
1048061520 8:130924138-130924160 CAGCACAAGGGGACCAATTCTGG - Intronic
1049852438 8:144840205-144840227 CAGCACATGAGGACCAGGCCTGG + Intronic
1057479837 9:95436151-95436173 CAGCACTTTGGGACCGAGGCAGG - Intergenic
1058581913 9:106467560-106467582 CATCACATGGTGACCTATGCAGG - Intergenic
1060408486 9:123384353-123384375 CAGCCCATGGGGAACTGGGCTGG + Intronic
1060969444 9:127729961-127729983 CAGTACATAGGGCCCTAGCCTGG + Intronic
1188994124 X:36861188-36861210 CTTAACAAGGGGACCTAGTCAGG + Intergenic
1193761857 X:85476749-85476771 CAGCAGATGGGGACATAATGAGG + Intergenic