ID: 964053935

View in Genome Browser
Species Human (GRCh38)
Location 3:152428728-152428750
Sequence AGGAGTGGCCAGGGCATTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964053929_964053935 3 Left 964053929 3:152428702-152428724 CCACTTACCAGAGATTCTGACGA 0: 1
1: 0
2: 0
3: 6
4: 82
Right 964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG 0: 1
1: 0
2: 4
3: 21
4: 292
964053928_964053935 27 Left 964053928 3:152428678-152428700 CCTAGGAGCTTTCAAAAAATACT 0: 1
1: 3
2: 3
3: 52
4: 384
Right 964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG 0: 1
1: 0
2: 4
3: 21
4: 292
964053931_964053935 -4 Left 964053931 3:152428709-152428731 CCAGAGATTCTGACGAGTGAGGA 0: 1
1: 0
2: 1
3: 17
4: 112
Right 964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG 0: 1
1: 0
2: 4
3: 21
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964053935 Original CRISPR AGGAGTGGCCAGGGCATTCA CGG Intronic
900221991 1:1513927-1513949 AGGAGGGGTCAGGGCACTCTGGG - Intronic
900403079 1:2480602-2480624 GTGAGTGGACTGGGCATTCAGGG + Intronic
900891774 1:5454709-5454731 GGTGGTGGGCAGGGCATTCAAGG + Intergenic
901255724 1:7824905-7824927 AGGACTCACCAGGGCATTCATGG - Intronic
901275743 1:7989772-7989794 AGCAGGGACCTGGGCATTCAAGG + Intergenic
902237960 1:15069718-15069740 AGGGCTGCCCAGGGCATCCAGGG + Intronic
902650344 1:17833168-17833190 AGAAGGGGCCACGGCATTCAGGG + Intergenic
904812448 1:33172321-33172343 AGGATGGGCCAGGGCATTGCAGG + Intronic
906359943 1:45146844-45146866 AGGAGTGGACTGGGTAATCAGGG - Intronic
907356595 1:53880027-53880049 AGTTCTGGCCAGGGCAATCAGGG + Intronic
908334097 1:63102474-63102496 AGTAGGGGCCAGGTCATTCCAGG + Intergenic
908915793 1:69124688-69124710 AGGATAGGCCTGGGCATTGAAGG + Intergenic
909013175 1:70356396-70356418 AGGAAGGGCCAGGTCATGCAGGG + Intronic
910348026 1:86263353-86263375 AGGAGTAGCCAGAGCTGTCATGG + Intergenic
911540977 1:99158158-99158180 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
912150891 1:106857354-106857376 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
912233374 1:107821641-107821663 TGGAGGGGCCAGGACATGCATGG + Intronic
912942529 1:114057899-114057921 AGGAGTGGGCAGAACAATCATGG - Intergenic
916249561 1:162723893-162723915 AAGAGTGGCAAAGCCATTCAGGG + Intronic
916505995 1:165428809-165428831 TGGAGAGCCCAGGGCATTGAGGG + Exonic
916825924 1:168441749-168441771 AGAAGTGGCCAGGGGCTTAAAGG + Intergenic
917483425 1:175432882-175432904 AGGAGTGGCCAGGTAATCAAGGG + Intronic
917668546 1:177249437-177249459 AGGAGTGGCCACTGCATTCAGGG - Intronic
918324847 1:183400051-183400073 AGTTCTGGCCAGGGCAATCAGGG + Intronic
919219531 1:194608520-194608542 AGTCCTGGCCAGGGCAATCAAGG - Intergenic
920252440 1:204630674-204630696 GGGAATGGCCAGGGCATTGGAGG - Intronic
923086008 1:230704029-230704051 AGAAGTAGCCAGAGCATTCTGGG - Intronic
923336130 1:232971763-232971785 AGGAGTAGCAAGGGCGATCAGGG + Intronic
1062980547 10:1718657-1718679 AGCAGGGGCCAGGGTCTTCACGG + Intronic
1063096226 10:2911388-2911410 AGGAGGGCCCAGGGTATTCCTGG + Intergenic
1063911738 10:10837041-10837063 AGGAGTGAGCAGGGAATTCCTGG - Intergenic
1064650757 10:17507129-17507151 AGGAGTGGCTTGCACATTCAGGG - Intergenic
1065459220 10:25938376-25938398 AGAAATGGCCAGATCATTCAGGG + Intronic
1065464725 10:26007370-26007392 AGTTCTGGCCAGGGCAATCAGGG + Intronic
1065590305 10:27256569-27256591 TGGAGTGCCCAGGGCAGTGAGGG + Intergenic
1065869286 10:29942246-29942268 TGGAGTGGCCATGGCATTTAGGG + Intergenic
1068776679 10:60874985-60875007 ACGAGTGGCGTGGGCATTGACGG - Exonic
1072416370 10:95249930-95249952 AGGAGTGGGCAGGACAGGCAGGG - Intronic
1073204761 10:101763053-101763075 AGGCCTGGGCATGGCATTCAGGG - Intergenic
1073943609 10:108726004-108726026 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1075574130 10:123566324-123566346 AGGAGTGTGCAGGGCATAGAAGG - Intergenic
1075865222 10:125712876-125712898 ACGAGTGCCCAGGGTACTCACGG - Intergenic
1077155225 11:1088138-1088160 AGGAGGGGGCAGGGCAGGCAGGG - Intergenic
1077359524 11:2134465-2134487 AGGAGAGGCCAGGGCGGGCAGGG + Intronic
1079102735 11:17551860-17551882 AGGAGTGGCTGGGGCACTGAGGG + Intronic
1081592499 11:44434371-44434393 GGGAGAGGCCAGGCCATGCAGGG - Intergenic
1082127442 11:48449813-48449835 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1083300925 11:61739310-61739332 GGCAGTGGCCAGAGCATTAAAGG - Intronic
1086567619 11:88244600-88244622 AGTTCTGGCCAGGGCAGTCAGGG + Intergenic
1087029652 11:93690032-93690054 AGGAGTGGCCAGAGAAGTAAGGG + Intronic
1089709942 11:120307415-120307437 ATGAGTGGCCGGTGCCTTCATGG - Intronic
1090248362 11:125233938-125233960 AGGTGGGGCCAGAGCATCCAGGG - Intronic
1090435498 11:126683622-126683644 ATGATTGGCCAGGGCATTGACGG + Intronic
1090443507 11:126744137-126744159 AGTGGTGGACAGGCCATTCATGG + Intronic
1090622778 11:128576147-128576169 GGGAGTTGCCAGGGCTCTCAAGG + Intronic
1090775801 11:129964405-129964427 AGGAACGGCTAGGGCATTCCAGG - Intronic
1090847372 11:130542104-130542126 AGGGGTGGGCAGGGCATGGATGG - Intergenic
1091064055 11:132492072-132492094 TGGTGTGGCCAGGACATTAAGGG + Intronic
1091133595 11:133167616-133167638 AGAGGTAGCCAGGGCACTCAAGG - Intronic
1091386756 12:100893-100915 GGGAGGGGCCAGGGAACTCAGGG - Intronic
1091601215 12:1918680-1918702 AGGAGAGGCCAGCGGATTAAAGG - Exonic
1092274792 12:7051532-7051554 AGTACTGGCCAGAGCAATCAGGG - Intronic
1093157121 12:15699785-15699807 AGTAGTGGAAAGGGCATTTAGGG - Intronic
1093627321 12:21364536-21364558 AGTTCTGGCCAGGGCAATCAGGG + Intronic
1095126200 12:38480343-38480365 AGGAGTGGAGAGGGAATTCTAGG + Intergenic
1096521831 12:52188867-52188889 AGGAGAGGCCAGGGGAGGCAGGG - Intronic
1097817857 12:64095488-64095510 AAGAGTGGCCAGGGCAGCCCTGG + Intronic
1099409908 12:82312484-82312506 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1102111049 12:110366110-110366132 GGGAGTGGCCTGGGCCTGCAGGG + Intergenic
1102191035 12:110988534-110988556 AGGGATGGCAAGGGCATTGATGG - Intergenic
1102549631 12:113682434-113682456 AGGAGTGACAAAGGCACTCAGGG - Intergenic
1102821830 12:115915086-115915108 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1103617309 12:122162504-122162526 AGGAGGGAGCAGGGGATTCAGGG - Intergenic
1104232396 12:126897931-126897953 AGGAGTGGCCAGGGAAGGGAGGG + Intergenic
1104492044 12:129202673-129202695 AGGAGTGGCCATGTGATTCAGGG - Intronic
1106422101 13:29593268-29593290 AGGATTGGCCGGTGGATTCATGG - Intronic
1107996939 13:45870436-45870458 AAAAGTGGCCATGGCATTCCTGG + Intergenic
1108718750 13:53108243-53108265 AGGAGTGGCATGGTCACTCATGG + Intergenic
1112003808 13:95236932-95236954 AGGAGTGCCAAGGGCAACCAGGG + Intronic
1112776606 13:102850440-102850462 AGCAGAGGCCAGATCATTCAAGG + Intronic
1113173595 13:107535183-107535205 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1113410001 13:110077095-110077117 AGTTCTGGCCAGGGCAATCAAGG - Intergenic
1113812203 13:113149707-113149729 AGGAATGCCCATGGCAGTCATGG - Intergenic
1114133153 14:19816697-19816719 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1118095144 14:62527995-62528017 AGGGGTGGCCAGGGAGTACATGG + Intergenic
1118733344 14:68684661-68684683 AGCAGTGGCCAGGGCAAGCATGG - Intronic
1118934604 14:70275364-70275386 AGTAGGGGCCAGAGCATTCTTGG + Intergenic
1119566126 14:75630820-75630842 AGGAATGACCAGGCCTTTCAGGG + Intronic
1120194500 14:81467444-81467466 AGGAGTGACTTGGGCATCCAAGG - Intergenic
1120397513 14:83986393-83986415 AAGAGTGGACAGGACAGTCATGG - Intergenic
1121520218 14:94581190-94581212 AGGAGTGCCCATGCCATTCCAGG + Intronic
1123576240 15:21672499-21672521 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1123612862 15:22114967-22114989 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1124106294 15:26740775-26740797 AGGAGTGGCCAAGGCTGTCCTGG - Intronic
1124648698 15:31458814-31458836 AGGAGTCACCAAGCCATTCATGG + Intergenic
1125003672 15:34795676-34795698 AGGACTGCCGAGGCCATTCATGG + Exonic
1125091399 15:35797132-35797154 AGAAGTAGCAAGGGCATTAATGG - Intergenic
1126269234 15:46793616-46793638 AGGAGTAGAAAGCGCATTCAAGG + Intergenic
1129234717 15:74217262-74217284 CTCAGTGGCCATGGCATTCAGGG + Intergenic
1129621616 15:77152491-77152513 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1130823312 15:87517892-87517914 AGGAGTGGCCAGGGGCTAAACGG - Intergenic
1202985108 15_KI270727v1_random:406744-406766 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1132482945 16:175655-175677 AGGTGTGGACGAGGCATTCAAGG - Intergenic
1133287268 16:4696436-4696458 AGCAGAGGACAGGGCAGTCAGGG + Intergenic
1133896352 16:9932922-9932944 AGGAGTGGCCAGGGCCCCCTGGG - Intronic
1137352093 16:47722440-47722462 AGTAGTGGCCAAGACATGCAAGG + Intergenic
1138530347 16:57631273-57631295 AGGAGTGGGCAGGACAGCCATGG + Intronic
1138531193 16:57635285-57635307 AGGTGTGGCCAGGACAGCCATGG - Intronic
1139600506 16:67983674-67983696 AGGAGTGGAGAGGGGATCCAGGG + Intergenic
1141192292 16:81833440-81833462 AGGAGAGGCCAGGGGCTTCCAGG - Intronic
1141626050 16:85261620-85261642 AGGAGAGGGCTGGGCATTGATGG + Intergenic
1142481948 17:224407-224429 ACGGGTGGGCAGGGCATTCTGGG - Intronic
1143047645 17:4095049-4095071 GGGAAAGGGCAGGGCATTCAGGG - Intronic
1143350654 17:6285735-6285757 AGGAGTGGCCTGTGCATGCATGG + Intergenic
1143777650 17:9209913-9209935 AGGTGGGGCCTGGGCAGTCAGGG + Intronic
1144678493 17:17176950-17176972 GGGAGGGGCCTGGGCACTCAGGG + Intronic
1144780164 17:17804065-17804087 AGGAGTGCCCAGAGCAGTGAGGG + Intronic
1144816042 17:18036132-18036154 AGGAATGGCCATGCCATTGAAGG - Intronic
1146600586 17:34211745-34211767 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1147162548 17:38576626-38576648 AGCAGTGGGTAGGGCATTCTTGG - Intronic
1148331557 17:46816953-46816975 TGGGGTGGCCAGGGCAGCCAGGG - Intronic
1148804195 17:50256103-50256125 AGGAGTGGGCAGGGCATCCAGGG - Intergenic
1148977514 17:51542658-51542680 AGGATTGGAAAGGGAATTCAGGG + Intergenic
1149139344 17:53411624-53411646 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1149255781 17:54824803-54824825 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1150030557 17:61729927-61729949 AGGAGTGTCCTGTGCATTCCAGG - Intronic
1150341719 17:64373924-64373946 GGGAGTGTCCAGGACATACAGGG - Intronic
1157101541 18:44734544-44734566 AAGTGTGGTCAGGGAATTCACGG - Intronic
1157428945 18:47607525-47607547 AGGAGTGGCTATGGTATCCACGG - Intergenic
1157900504 18:51511316-51511338 AAAAGTGGCCAGAGCATTAATGG - Intergenic
1158314807 18:56200061-56200083 AGGCAGGGCCAGGGCAGTCACGG - Intergenic
1161003459 19:1922943-1922965 AGGAGTGGACAGCTCATACAAGG - Intronic
1161470775 19:4455883-4455905 ATGAGTGCCCAGGGCCTCCAAGG - Intronic
1162295267 19:9809144-9809166 AGGAGTGGGCAGGGCCTTGCAGG - Intergenic
1162384776 19:10354294-10354316 AGGAGTGGCCCGGGAAATCGGGG - Intronic
1162551865 19:11362385-11362407 GGGAGTGGCCAGGGGCTCCAGGG - Intronic
1162930342 19:13954310-13954332 AGGGGTGGCCAGGGCACTTCAGG - Intronic
1165735284 19:38171952-38171974 AGCAGTGGCCAGAACATTCAGGG + Intronic
1165811469 19:38614364-38614386 AGGAGAGGCCTGGGGATTCTGGG - Intronic
1166681560 19:44770752-44770774 AGGCGTGGCCAGGGCCTCGAAGG + Intergenic
1166790770 19:45397062-45397084 TGGGGAGGCCAGGGCATTGAGGG + Intronic
1167291849 19:48629091-48629113 AGGAGAGGCCAGGGCAGGCTGGG - Exonic
929107101 2:38376664-38376686 AGGGGTGGCCAGGGCATGATGGG - Intronic
929776344 2:44933204-44933226 AAGAGTGGCCAGGGCTCTCCTGG + Intergenic
930816370 2:55602329-55602351 AGGAGTGGCCTGTGCAGTAAAGG + Intronic
931824070 2:65981152-65981174 AGGACTGGCCAAGGCATCCAGGG - Intergenic
931825347 2:65994731-65994753 CTGAGTGGCCAGGGTATTAATGG - Intergenic
932089493 2:68792323-68792345 AGTAGTGGCCAGGTCTTTTAGGG + Intronic
933043566 2:77503022-77503044 AGGCAGGGCCAGGTCATTCAGGG + Intronic
933271828 2:80240964-80240986 GGCAGTGGGAAGGGCATTCATGG - Intronic
933465502 2:82645881-82645903 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
935062380 2:99619951-99619973 CTGAGTGGCCAGGGTCTTCAGGG - Intronic
935172083 2:100618034-100618056 AGGAGAGACCAGGCCATTGAAGG + Intergenic
936877530 2:117209910-117209932 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
937061386 2:118982625-118982647 AGGTTTGGTCATGGCATTCAAGG - Intronic
937198908 2:120184223-120184245 AGGAATGTCCAGGGCATACCCGG + Intergenic
937991125 2:127663162-127663184 GCGAGTGGCCAGGGCACTGATGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
938947376 2:136225319-136225341 AGGAGTGCCCAGGGCATGGGAGG + Intergenic
940731631 2:157399602-157399624 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
942149038 2:173056700-173056722 AGGAGTGGGCAGGGGACCCAGGG + Intergenic
942156344 2:173132524-173132546 AGGAGGGGCTAGGGCTTTGAAGG - Intronic
945791074 2:214306378-214306400 AGTTCTGGCCAGGGCAGTCAGGG - Intronic
946230072 2:218285868-218285890 GGAAGTGGCCAGGGCCCTCATGG - Exonic
946393954 2:219434224-219434246 AAGAGTGGGCAGGACATTCCAGG - Intergenic
947634536 2:231673363-231673385 AGGAGGGGCCATGCCTTTCAGGG - Intergenic
947805010 2:232960452-232960474 AGGTATGGCCAGGGTAATCACGG - Intronic
949030421 2:241794312-241794334 AGCAGTTCCCAGGGCATTCGGGG - Intronic
1170721765 20:18887135-18887157 TGGAATGACCAGAGCATTCATGG + Intergenic
1170946642 20:20896702-20896724 AGGAGTGGAAAGGGCATGGAGGG + Intergenic
1172501596 20:35432005-35432027 AGGAGTGGGCTGGGGATCCAGGG - Intergenic
1173480312 20:43393438-43393460 AGGAATGGCCAGAGAATCCATGG - Intergenic
1174394767 20:50240180-50240202 AGGAATGGGGAGGGCATTCCAGG + Intergenic
1175310914 20:58011090-58011112 AGGAGTCGCCAGGGGATTCTAGG - Intergenic
1175332856 20:58176891-58176913 AGCAGGGGCCTGGGCATCCAGGG + Intergenic
1176814962 21:13590779-13590801 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1176941961 21:14935849-14935871 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1177130048 21:17244598-17244620 AGTGCTGGCCAGGGCAATCAAGG + Intergenic
1178043757 21:28671109-28671131 AGGAGGGGCAAGAGCCTTCACGG + Intergenic
1178529263 21:33361554-33361576 GGGAGAGGCCAGACCATTCAGGG + Intergenic
1180147306 21:45928595-45928617 AGGGGTGGCCAGGGCAAGCATGG + Intronic
1181436648 22:22914950-22914972 ACGAAAGGCCATGGCATTCAGGG + Intergenic
1182861562 22:33563896-33563918 GGGAGTGACCAGGGCAAGCAAGG + Intronic
1183204471 22:36409267-36409289 AGGAATGGCAAGGGCAGTCAAGG + Intergenic
1183342850 22:37291530-37291552 AGGAGCGGCCTGGGCAAACATGG + Intronic
1183474559 22:38028897-38028919 TGGAGTGGCCGGGGCTTGCAGGG - Intronic
1183487608 22:38097812-38097834 AGGAGAGGCCCGGGGATTCTGGG + Intronic
1184187924 22:42877056-42877078 AGGAGTTGCCAGGACCCTCACGG - Intronic
950554435 3:13686599-13686621 AGGGGTGGCAAGGGCATTCTAGG + Intergenic
950859355 3:16133907-16133929 AACAGTGGACAAGGCATTCAGGG + Intergenic
951218339 3:20044514-20044536 AGCAGTAGCCAGGCCATGCAGGG - Intronic
951833425 3:26955633-26955655 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
953919593 3:46942878-46942900 AGAAGTGGGAAGGGCATTCCCGG + Intronic
954108174 3:48420174-48420196 AGGGGTGGCCAGGGCTTTGGGGG + Exonic
954809249 3:53238075-53238097 GGAAGGGGCCAGGGCATCCAGGG - Intronic
954812448 3:53256356-53256378 AGGCTTGGCAAGGGCAATCAAGG + Intergenic
955345848 3:58161330-58161352 AGGATTGGTCAGGGCCTTAAAGG + Intronic
956570440 3:70688686-70688708 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
957689603 3:83550810-83550832 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
957844752 3:85717494-85717516 AGTTCTGGCCAGGGCAATCAGGG - Intronic
958037351 3:88186082-88186104 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
961021754 3:123513447-123513469 AGGAGTGGGAAGGGTAGTCATGG + Intronic
961310971 3:126000664-126000686 AGTTCTGGCCAGGGCAATCAAGG + Intergenic
961448233 3:126991077-126991099 AGGAGAGGGCAGGGCAGGCAGGG - Intronic
962219365 3:133550845-133550867 GGGAGTGGCTAGTGCATGCAGGG - Intergenic
963779419 3:149472229-149472251 TGAAGTGGTCAGGGCATTCCAGG + Intergenic
964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG + Intronic
964807719 3:160629886-160629908 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
966851847 3:184169737-184169759 AAGCTTGGCCAGGGCCTTCAAGG + Intronic
967549498 3:190773963-190773985 CGGAGAGGCCAGGGCATTGGAGG + Intergenic
968309661 3:197673108-197673130 AGAAGTGCCCAGGTCCTTCAGGG - Intronic
969500248 4:7548329-7548351 AGGCTTGGCCAGAGCATCCAAGG - Intronic
969929236 4:10613972-10613994 GAGGGTGGCCTGGGCATTCAGGG - Intronic
970430317 4:15983032-15983054 ATGAGTCACCAGTGCATTCAAGG - Intronic
970672818 4:18415802-18415824 AGAAGTGGCCAGTGCATTAGGGG - Intergenic
971497347 4:27280889-27280911 AGGAGTGGCCAGTTCATGAAGGG - Intergenic
973042213 4:45483771-45483793 AGTAATGGGCAGGGCATTCTAGG + Intergenic
973563036 4:52155621-52155643 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
977564944 4:98571265-98571287 ATGAGTGGCCACGGACTTCAGGG - Intronic
977607062 4:98994602-98994624 TTGAGAGGCCAGGGCATCCAGGG - Intergenic
977821306 4:101475421-101475443 GGGAGGAGCCAGGGCATTTATGG + Intronic
977946845 4:102923551-102923573 AGTTCTGGCCAGGGCAATCAGGG + Intronic
979583464 4:122387541-122387563 AGTTCTGGCCAGGGCAATCAGGG - Intronic
980687987 4:136255067-136255089 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
980958284 4:139450464-139450486 AGGAGTGCCAGTGGCATTCAAGG + Intergenic
981306753 4:143254659-143254681 GGGAGTGGCCAGGGCGTGCGAGG - Intergenic
982181679 4:152753610-152753632 AGGAGTGGGAAGGACATTCTAGG + Intronic
982187209 4:152814763-152814785 AGCAGTGGCCAGGGTACCCAGGG - Intronic
982528660 4:156510030-156510052 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
984158915 4:176227082-176227104 ATGAGTGGTCATGGCAGTCAGGG + Intronic
985787333 5:1904121-1904143 AGGAGAGGGGAGAGCATTCAAGG + Intergenic
986812249 5:11372903-11372925 AGGAGAGACCACGGCATTGATGG - Intronic
987410966 5:17614762-17614784 AGAAGAGGCCAGGGCTTTTATGG + Intergenic
988176492 5:27732258-27732280 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
989831376 5:45923760-45923782 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
991224756 5:64257205-64257227 AGTTCTGGCCAGGGCAATCAGGG - Intronic
993793035 5:92231094-92231116 AGGAGTAGACAGAGCATTCCTGG - Intergenic
994026580 5:95091237-95091259 AGAGGTGGACAGGGCATTGAAGG - Intronic
994390172 5:99182916-99182938 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
994574867 5:101565513-101565535 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
995816108 5:116169977-116169999 AGCCCTGGCCAGGGCAATCAGGG + Intronic
999198526 5:149799608-149799630 AGGAGAAGCTGGGGCATTCAGGG + Intronic
1000124412 5:158229641-158229663 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1001180853 5:169519027-169519049 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1001335029 5:170789807-170789829 AGGAGAGGCCAGGGATGTCAGGG - Intronic
1003743183 6:8967154-8967176 AGGAGAGACAAGGGCATGCATGG - Intergenic
1005225474 6:23637271-23637293 AGGAGTGTGCAGGGAAATCAGGG + Intergenic
1005809018 6:29502254-29502276 AGGTGTGGCCTGGGGATTGAAGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006314013 6:33279728-33279750 AAGACGGGCCTGGGCATTCAGGG + Intronic
1007739799 6:44003427-44003449 AGGAGTGGCAAAGGCACGCAGGG + Exonic
1010289636 6:74120375-74120397 AGTTCTGGCCAGGGCAATCAAGG + Intergenic
1012603838 6:101132490-101132512 AGGAGGGGCCACAGCATTGAAGG - Intergenic
1013458903 6:110357489-110357511 TGGCGTGGACAGGCCATTCACGG + Intronic
1014375493 6:120667287-120667309 AGTTCTGGCCAGGGCAGTCAGGG - Intergenic
1016471431 6:144378691-144378713 AGGAGTGGTCAGATGATTCAGGG + Intronic
1016840351 6:148518883-148518905 AGGAGCAGCCAGGGCGTTTAAGG - Intronic
1017137368 6:151160260-151160282 AGGTGTGACCATGACATTCAAGG - Intergenic
1018863388 6:167729638-167729660 AGTGGTTGCCAGGGCTTTCAGGG + Intergenic
1019216526 6:170447386-170447408 AGGTGTGGAGAGGGCACTCATGG + Intergenic
1020564135 7:9774705-9774727 AGTTCTGGCCAGGGCAATCAAGG - Intergenic
1020574054 7:9903108-9903130 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1021814719 7:24435982-24436004 AGGAGTGGCATGGGCATACAGGG - Intergenic
1023455637 7:40335750-40335772 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1024291579 7:47808084-47808106 GGGAGTGGCCAGGACAGTGAAGG - Intronic
1025995358 7:66524183-66524205 AGGGCTGGCCAGAGCCTTCAGGG + Intergenic
1028510582 7:91621017-91621039 GGGAGTGGCCAGAGCATGGAGGG - Intergenic
1028636366 7:92993949-92993971 AGCAGTTGCCAGGGAATTAAAGG - Intergenic
1029103406 7:98153295-98153317 GGGAGAGGCCAGTGCAGTCAGGG + Intronic
1029205618 7:98867837-98867859 AGGGATGGCCAGGACATCCAGGG + Intronic
1031479150 7:122257364-122257386 TGGCGTGGCCAGGGCAGGCATGG + Intergenic
1032502693 7:132411887-132411909 TGGGGTGGTCAGAGCATTCAGGG - Intronic
1034497196 7:151430202-151430224 AGGTGGGGCCAGGGCATTAGGGG + Intronic
1034739117 7:153456957-153456979 GGGAGTGGAAAAGGCATTCAGGG - Intergenic
1035354569 7:158269294-158269316 AGGCATGGCCTTGGCATTCAGGG - Intronic
1035546051 8:483239-483261 AGGAGGGGCGAGGGGCTTCAGGG - Intergenic
1036370518 8:8158831-8158853 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1036651804 8:10648970-10648992 AGGAGGGGCCAGGGCAGTGAGGG + Intronic
1036880374 8:12506800-12506822 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1038821127 8:30952729-30952751 AGGAAAGGCCAGAGCATGCAGGG + Intergenic
1039281139 8:35986300-35986322 AGTTCTGGCCAGGGCAATCAAGG - Intergenic
1039987712 8:42461916-42461938 AGAAGTGGCCAGGGCAGTCATGG + Intronic
1044337338 8:91002796-91002818 AGGAGTAGCCAGGCCATTCTAGG + Intronic
1045184558 8:99824123-99824145 AGCAGTGACCATGACATTCATGG - Intronic
1046130287 8:109959194-109959216 AGAAGAGGCCATGGGATTCATGG + Intergenic
1047363963 8:124195411-124195433 AGGAGAGGCCAAGGCATTTTTGG - Intergenic
1047404866 8:124577042-124577064 AGTAGTGGGCAAGGCACTCAAGG + Intronic
1047422813 8:124721216-124721238 AGGTGTGGCTAGTGCAGTCAAGG - Intronic
1047632807 8:126726685-126726707 AGGAGAGGCCAGGTCCTCCAAGG + Intergenic
1049443809 8:142620966-142620988 TGGAGTGGACGGGGCATTCTGGG - Intergenic
1049583956 8:143424480-143424502 AGGAGAGGCCAAGGCAGCCAGGG + Intronic
1050112845 9:2234595-2234617 AGGAGTGGCAAGGGTTTTTAAGG + Intergenic
1051341746 9:16118628-16118650 TGGAATGACCAGGGCATTTATGG + Intergenic
1051458054 9:17283599-17283621 AGTTCTGGCCAGGGCAGTCAGGG - Intronic
1051610127 9:18953625-18953647 AGGGGTATTCAGGGCATTCATGG - Intronic
1052127112 9:24790923-24790945 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1054803606 9:69377392-69377414 GGTGGTGGTCAGGGCATTCAAGG - Exonic
1056143741 9:83708581-83708603 AGGATTGCGCAGGGCAGTCACGG - Intergenic
1057110396 9:92464465-92464487 AGGAATGGACATGCCATTCAAGG - Intronic
1057750586 9:97789454-97789476 AGAAGTGGGCAGGGCATTCCAGG + Intergenic
1060588610 9:124802079-124802101 AGAAGTGACAAGGGCTTTCAGGG + Intronic
1060864923 9:126988113-126988135 ATGAGTGGCCAGGAAATACAAGG + Intronic
1061153940 9:128845866-128845888 AGGCCTGACCAGGTCATTCAGGG - Intronic
1061378976 9:130242948-130242970 AGGAGAGGCAAGGGCATTCCAGG + Intergenic
1061387734 9:130300357-130300379 AGCAGTGGGCAGGGCAGACATGG + Intronic
1062097263 9:134709876-134709898 GGGAGTGCCCAGGGCAGGCAGGG + Intronic
1062123144 9:134845000-134845022 AGGAGTGGCCAAGGCTGGCATGG + Intergenic
1062463333 9:136670948-136670970 AGGAGTGGACAGTGCAATGAAGG + Exonic
1203532396 Un_GL000213v1:158656-158678 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1188360931 X:29252390-29252412 CCTAGTGGCCAGGGCATACAGGG + Intronic
1189077547 X:37932985-37933007 AGGAGTTGCCAGGGCAGTTATGG + Intronic
1189383575 X:40518919-40518941 AAGCGTGGCCAGGGCTTTCAGGG - Intergenic
1190209932 X:48437580-48437602 AGTTCTGGCCAGGGCAATCAGGG + Intergenic
1190392317 X:49944407-49944429 AGTTCTGGCCAGGGCAATCAGGG - Intronic
1192371475 X:70517124-70517146 AGTTCTGGCCAGGGCAATCAGGG - Intergenic
1195406970 X:104525118-104525140 AGCAGTTGTCAGGGCATCCATGG + Intergenic
1196284483 X:113863694-113863716 AGGAGTGGCCATGGTCTCCATGG - Intergenic