ID: 964055175

View in Genome Browser
Species Human (GRCh38)
Location 3:152446668-152446690
Sequence CAGCGAGCACATGATGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964055175_964055178 0 Left 964055175 3:152446668-152446690 CCATTGCCATCATGTGCTCGCTG 0: 1
1: 1
2: 0
3: 3
4: 103
Right 964055178 3:152446691-152446713 CCTGCTAATTAAGACTCAGTCGG 0: 1
1: 0
2: 0
3: 10
4: 105
964055175_964055179 30 Left 964055175 3:152446668-152446690 CCATTGCCATCATGTGCTCGCTG 0: 1
1: 1
2: 0
3: 3
4: 103
Right 964055179 3:152446721-152446743 ATCACTGAAGCGACCCCTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964055175 Original CRISPR CAGCGAGCACATGATGGCAA TGG (reversed) Intronic
903112697 1:21150241-21150263 CGGCAAGGACAAGATGGCAAAGG + Intronic
903771950 1:25769807-25769829 CGGCGGGCACCCGATGGCAAGGG + Intronic
914466862 1:147937296-147937318 CAGAGATCACATGCTGGAAAGGG + Intronic
918523368 1:185439221-185439243 CAGTGAGGACATGAAGGTAATGG + Intergenic
922039370 1:221881434-221881456 CAGTGGGCAGGTGATGGCAAGGG - Intergenic
923248217 1:232154402-232154424 CAGTGAGCAAATTAAGGCAATGG - Intergenic
924131557 1:240914674-240914696 CAGAGAGCAGATGTTTGCAAGGG - Intronic
1063867982 10:10388003-10388025 CAAGAAGCACATGATGGCCAGGG - Intergenic
1064000231 10:11657793-11657815 CAGCAAACTCATGGTGGCAAGGG - Intergenic
1064972596 10:21081302-21081324 CAGCTGGCACAGGATGACAAAGG + Intronic
1067553089 10:47248698-47248720 CAGGTAGCACATGCTGGGAAGGG + Intergenic
1076073711 10:127514684-127514706 CAGCTAGCAGAGGATGGCGATGG - Intergenic
1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG + Intronic
1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG + Intronic
1084118187 11:67054017-67054039 GAGCGACCACATGAGGGCAGTGG + Intergenic
1085344382 11:75758509-75758531 CAGAGTGCACATGATTGCAGAGG + Intergenic
1090101838 11:123805726-123805748 CAGGGAGCTCAGGATGACAAGGG + Exonic
1090256736 11:125289718-125289740 CAGCCAGGACCTGATGGAAAAGG + Intronic
1091403680 12:196148-196170 CAGGTAGCACATGACGGCGATGG + Exonic
1094088680 12:26623300-26623322 CAGCGTGGAGATGCTGGCAAAGG - Intronic
1095996089 12:48085807-48085829 CAGCTAGGAAAAGATGGCAAGGG + Intronic
1097480309 12:60116089-60116111 CAGAGATCACATGATGAGAAAGG + Intergenic
1099864632 12:88264245-88264267 CAGAGAACACGTGATGGCAGAGG + Intergenic
1100124389 12:91406161-91406183 CAGAGATCACATGATGAGAAAGG + Intergenic
1108176055 13:47794023-47794045 CCACGAGCACATGGTGACAAAGG - Intergenic
1109075347 13:57827265-57827287 GAGGGAGCCCAAGATGGCAAAGG + Intergenic
1110979294 13:81875121-81875143 CAGCGAGAACATTATGGCAGTGG + Intergenic
1112190331 13:97170980-97171002 CAGTGAGAAAATTATGGCAATGG - Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1117479239 14:56126632-56126654 CAGGAAGCACAAGATGGGAAAGG - Intronic
1122971864 14:105155504-105155526 CAGTGAGGACGTGAGGGCAAAGG + Intronic
1123699569 15:22904194-22904216 CAGCGGGCACATGGGGGGAAGGG - Intronic
1124026708 15:25973548-25973570 CAGCGAGACCATGAACGCAATGG + Intergenic
1126176854 15:45743801-45743823 CAGCTACCACAGGATGACAAAGG + Intergenic
1128254300 15:66185688-66185710 CAGCGACATCAGGATGGCAAAGG + Intronic
1135471257 16:22733198-22733220 CAGCGAGCACAGGAAGGAGAGGG - Intergenic
1140558165 16:75945651-75945673 CAGCCAGCACATTATTGCATAGG + Intergenic
1141576089 16:84964282-84964304 CAGCAAGCACGTGCTGGCACAGG - Intergenic
1146788996 17:35741233-35741255 CAGCGTGCACGTGCTTGCAACGG - Exonic
1147203993 17:38823739-38823761 CAGGGAGGACAAGATGGGAAGGG - Intronic
1162071565 19:8155328-8155350 CAGCTAGAACATCAAGGCAATGG - Intronic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1164683301 19:30150261-30150283 CAGTGAGCACCTGATTGCAGGGG + Intergenic
925666127 2:6258145-6258167 CAGCTAGCAAATGATGGAACTGG - Intergenic
927134861 2:20089624-20089646 CAGTGAGAACATTATGGCAATGG + Intergenic
927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG + Intronic
929698106 2:44137251-44137273 CAGCGAGAATTTGAAGGCAAGGG - Intergenic
933971964 2:87477095-87477117 CAGTGAGCACATGGAGGTAAAGG + Intergenic
936321762 2:111473102-111473124 CAGTGAGCACATGGAGGTAAAGG - Intergenic
936719469 2:115233529-115233551 CAAGGAGCACATGAAGGCGATGG - Intronic
938193130 2:129300690-129300712 CAGCGAGCTCTTCATGGAAAGGG + Intergenic
939106623 2:137956019-137956041 CAGCGAGCACAGGAGGAGAAAGG + Intergenic
948373657 2:237505991-237506013 CAGTGGGGAGATGATGGCAAAGG - Intronic
1175520651 20:59600596-59600618 CAGGGAGCACATCACTGCAAAGG - Intronic
1176246147 20:64098119-64098141 TGCCGAGCCCATGATGGCAACGG - Exonic
1179892365 21:44342741-44342763 CTGAGAGCACAGGATGGGAACGG - Intergenic
1185392387 22:50569649-50569671 CAGGTAGCAGATGATGGCTATGG - Exonic
949707980 3:6840815-6840837 CAGTGAGAAAATTATGGCAATGG + Intronic
955199522 3:56837819-56837841 CTGTGTGCACATGATGGCACAGG - Intronic
962747100 3:138404964-138404986 CTGAGAGCACACAATGGCAAAGG - Exonic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
965395978 3:168160804-168160826 AAGGGAGCAGATGAGGGCAAGGG + Intergenic
966191363 3:177274403-177274425 GAGCGTGGACATGATGGCAGAGG - Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
972571565 4:40315481-40315503 AAGGGAACAGATGATGGCAAAGG - Intergenic
973822326 4:54673149-54673171 CAGCGAGCACATTGTGTCTATGG - Intronic
976285846 4:83370519-83370541 ACGGGAGCACCTGATGGCAAAGG - Intergenic
977175470 4:93814890-93814912 CAGAGGTCACATGATGGGAAAGG - Intergenic
980760704 4:137230128-137230150 CAGAGATCACATGATGTAAATGG + Intergenic
982673062 4:158345638-158345660 CACGGAGCACATGTTGGAAAAGG - Intronic
988255217 5:28810383-28810405 CAGCGGGCACAGGACGGCAGGGG - Intergenic
989663386 5:43824361-43824383 CATTGAGAACATGATGACAATGG - Intergenic
990177030 5:53119194-53119216 CGGCAAGCACCTGATAGCAAGGG + Intergenic
999343593 5:150795529-150795551 CAACGAGGTCATGATGACAATGG - Exonic
1002583863 5:180228968-180228990 CTGCCAGCACATAATGGCAACGG + Intergenic
1003169617 6:3710817-3710839 CAGAGAGCACAGGATGCCCACGG + Intergenic
1004530467 6:16450451-16450473 CAGAGAGCACTAGATGGGAAGGG - Intronic
1004846208 6:19645389-19645411 CATAGAGCACATGATGGCCTGGG - Intergenic
1005822211 6:29607321-29607343 CAGGGAGCTCATGGTGGCACAGG + Intronic
1005882742 6:30073392-30073414 CAGTGAGAACGTGATGGCTATGG + Intronic
1006879541 6:37327118-37327140 CAGGGAGTACATGGTGGCATGGG + Intronic
1007132300 6:39486770-39486792 CAGCAATAACATGATTGCAAAGG + Intronic
1007180142 6:39923691-39923713 CAGCCAGCACAGGATGACAGAGG + Intronic
1008685176 6:53918077-53918099 CTGTGAGCACATGGTGGCACTGG + Intronic
1009921925 6:70072787-70072809 CAGCCCACACTTGATGGCAAAGG + Intronic
1010585807 6:77657773-77657795 CAGAGAGCATATAATGGCATAGG - Intergenic
1013602985 6:111721968-111721990 CAGCTGGCACAGGATGGGAAGGG + Intronic
1018543299 6:164907569-164907591 CAGGGTGCACTTGATGGTAAGGG - Intergenic
1024012300 7:45279515-45279537 CAGCCTGAACAAGATGGCAAAGG + Intergenic
1024018614 7:45344055-45344077 CAAAGAGCACATTATGGAAAAGG + Intergenic
1025244069 7:57302950-57302972 GAATGAGTACATGATGGCAAAGG - Intergenic
1026455532 7:70569215-70569237 CAGCCAGCACGTTATGGGAAAGG + Intronic
1028218893 7:88170611-88170633 TAACGGGCACATGACGGCAAAGG - Intronic
1034591184 7:152140752-152140774 CCGGGAGCACATGGTGGGAAGGG + Intronic
1036659800 8:10700587-10700609 CAGAGACCAGATGATGGCATGGG - Exonic
1036670235 8:10778998-10779020 CAGCTATCACATGATTGAAATGG + Intronic
1037553318 8:19996396-19996418 CAGAGAGCATAGGATGGCAGGGG + Intergenic
1038395877 8:27245007-27245029 CAGCCAGCACAGAAAGGCAAGGG - Intronic
1040690928 8:49937379-49937401 CAGCGTGCTGATAATGGCAATGG + Intronic
1043364903 8:79521373-79521395 CAGCCAGCAGAGTATGGCAAGGG + Intergenic
1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG + Intronic
1049090349 8:140509965-140509987 CAGGGAGCACATTTTGGCAGAGG - Intergenic
1051415140 9:16831862-16831884 CACTGAGCAAATAATGGCAATGG + Intronic
1053499347 9:38571158-38571180 TAGTGAGCGCATGATGGGAAGGG + Exonic
1054965891 9:71026459-71026481 GGGCGAGTACATGAAGGCAAAGG - Intronic
1055936424 9:81608569-81608591 AAGCAACCACATGAAGGCAAGGG + Intronic
1056377378 9:86028041-86028063 CATCAAGGACAAGATGGCAACGG + Intronic
1199076639 X:143533395-143533417 CAGTGAGCACATGAGGGTAGAGG - Intergenic