ID: 964060716

View in Genome Browser
Species Human (GRCh38)
Location 3:152518833-152518855
Sequence GTGCACTAGACAACAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964060716_964060722 17 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060722 3:152518873-152518895 ACAATATAATATCGGAAAGGGGG No data
964060716_964060723 18 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060723 3:152518874-152518896 CAATATAATATCGGAAAGGGGGG No data
964060716_964060720 15 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060720 3:152518871-152518893 TTACAATATAATATCGGAAAGGG No data
964060716_964060719 14 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060719 3:152518870-152518892 TTTACAATATAATATCGGAAAGG No data
964060716_964060718 9 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060716_964060721 16 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060721 3:152518872-152518894 TACAATATAATATCGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964060716 Original CRISPR GTGCACTAGACAACAATGGA TGG (reversed) Intergenic
No off target data available for this crispr