ID: 964060718

View in Genome Browser
Species Human (GRCh38)
Location 3:152518865-152518887
Sequence TATACTTTACAATATAATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964060714_964060718 15 Left 964060714 3:152518827-152518849 CCCTATCCATCCATTGTTGTCTA No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060716_964060718 9 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060712_964060718 27 Left 964060712 3:152518815-152518837 CCCTCTCATTTTCCCTATCCATC No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060715_964060718 14 Left 964060715 3:152518828-152518850 CCTATCCATCCATTGTTGTCTAG No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060713_964060718 26 Left 964060713 3:152518816-152518838 CCTCTCATTTTCCCTATCCATCC No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data
964060717_964060718 5 Left 964060717 3:152518837-152518859 CCATTGTTGTCTAGTGCACAATA No data
Right 964060718 3:152518865-152518887 TATACTTTACAATATAATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964060718 Original CRISPR TATACTTTACAATATAATAT CGG Intergenic
No off target data available for this crispr