ID: 964060721

View in Genome Browser
Species Human (GRCh38)
Location 3:152518872-152518894
Sequence TACAATATAATATCGGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964060715_964060721 21 Left 964060715 3:152518828-152518850 CCTATCCATCCATTGTTGTCTAG No data
Right 964060721 3:152518872-152518894 TACAATATAATATCGGAAAGGGG No data
964060714_964060721 22 Left 964060714 3:152518827-152518849 CCCTATCCATCCATTGTTGTCTA No data
Right 964060721 3:152518872-152518894 TACAATATAATATCGGAAAGGGG No data
964060716_964060721 16 Left 964060716 3:152518833-152518855 CCATCCATTGTTGTCTAGTGCAC No data
Right 964060721 3:152518872-152518894 TACAATATAATATCGGAAAGGGG No data
964060717_964060721 12 Left 964060717 3:152518837-152518859 CCATTGTTGTCTAGTGCACAATA No data
Right 964060721 3:152518872-152518894 TACAATATAATATCGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964060721 Original CRISPR TACAATATAATATCGGAAAG GGG Intergenic
No off target data available for this crispr