ID: 964065796

View in Genome Browser
Species Human (GRCh38)
Location 3:152577294-152577316
Sequence CTGTAATCCCAGCTACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964065791_964065796 18 Left 964065791 3:152577253-152577275 CCATCTCTACAAAAAAATACACT No data
Right 964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964065796 Original CRISPR CTGTAATCCCAGCTACTGGA GGG Intergenic
No off target data available for this crispr