ID: 964072611

View in Genome Browser
Species Human (GRCh38)
Location 3:152653133-152653155
Sequence TTTAGGTTCTTGAATTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964072611_964072617 1 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072617 3:152653157-152653179 TAATGGAGTGGTTTAGGATTAGG No data
964072611_964072618 2 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072618 3:152653158-152653180 AATGGAGTGGTTTAGGATTAGGG No data
964072611_964072621 8 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072621 3:152653164-152653186 GTGGTTTAGGATTAGGGCTGGGG No data
964072611_964072620 7 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072620 3:152653163-152653185 AGTGGTTTAGGATTAGGGCTGGG No data
964072611_964072616 -5 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072616 3:152653151-152653173 CTAAAATAATGGAGTGGTTTAGG No data
964072611_964072619 6 Left 964072611 3:152653133-152653155 CCACCAGAATTCAAGAACCTAAA No data
Right 964072619 3:152653162-152653184 GAGTGGTTTAGGATTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964072611 Original CRISPR TTTAGGTTCTTGAATTCTGG TGG (reversed) Intergenic
No off target data available for this crispr