ID: 964082465

View in Genome Browser
Species Human (GRCh38)
Location 3:152776163-152776185
Sequence CTCTCTGAAGAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964082460_964082465 -4 Left 964082460 3:152776144-152776166 CCTTTGGATGCATCTCCTCCTCT No data
Right 964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG No data
964082457_964082465 22 Left 964082457 3:152776118-152776140 CCGGGGCTAACTTACTGGCCATG No data
Right 964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG No data
964082459_964082465 4 Left 964082459 3:152776136-152776158 CCATGTAACCTTTGGATGCATCT No data
Right 964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964082465 Original CRISPR CTCTCTGAAGAAATGGAGCT GGG Intergenic
No off target data available for this crispr