ID: 964085148

View in Genome Browser
Species Human (GRCh38)
Location 3:152808255-152808277
Sequence GAACTCTGAGGGTTAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964085148_964085152 -5 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085152 3:152808273-152808295 AGTTCATGCATCTGTTTAGTTGG No data
964085148_964085153 -4 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085153 3:152808274-152808296 GTTCATGCATCTGTTTAGTTGGG No data
964085148_964085154 3 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085154 3:152808281-152808303 CATCTGTTTAGTTGGGATAGTGG No data
964085148_964085157 18 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085157 3:152808296-152808318 GATAGTGGCTGTGTGTTGGGTGG No data
964085148_964085158 26 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085158 3:152808304-152808326 CTGTGTGTTGGGTGGCATAATGG No data
964085148_964085155 14 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085155 3:152808292-152808314 TTGGGATAGTGGCTGTGTGTTGG No data
964085148_964085156 15 Left 964085148 3:152808255-152808277 CCATTTCCTAACCCTCAGAGTTC No data
Right 964085156 3:152808293-152808315 TGGGATAGTGGCTGTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964085148 Original CRISPR GAACTCTGAGGGTTAGGAAA TGG (reversed) Intergenic
No off target data available for this crispr