ID: 964090147

View in Genome Browser
Species Human (GRCh38)
Location 3:152866252-152866274
Sequence ACATGCAAAGGGCCTTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964090147_964090151 25 Left 964090147 3:152866252-152866274 CCTTAGAAAGGCCCTTTGCATGT No data
Right 964090151 3:152866300-152866322 AGTATGAACAATTCTGCGTGTGG No data
964090147_964090152 26 Left 964090147 3:152866252-152866274 CCTTAGAAAGGCCCTTTGCATGT No data
Right 964090152 3:152866301-152866323 GTATGAACAATTCTGCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964090147 Original CRISPR ACATGCAAAGGGCCTTTCTA AGG (reversed) Intergenic
No off target data available for this crispr