ID: 964090151

View in Genome Browser
Species Human (GRCh38)
Location 3:152866300-152866322
Sequence AGTATGAACAATTCTGCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964090149_964090151 14 Left 964090149 3:152866263-152866285 CCCTTTGCATGTAGGACTCAATA No data
Right 964090151 3:152866300-152866322 AGTATGAACAATTCTGCGTGTGG No data
964090150_964090151 13 Left 964090150 3:152866264-152866286 CCTTTGCATGTAGGACTCAATAA No data
Right 964090151 3:152866300-152866322 AGTATGAACAATTCTGCGTGTGG No data
964090146_964090151 26 Left 964090146 3:152866251-152866273 CCCTTAGAAAGGCCCTTTGCATG No data
Right 964090151 3:152866300-152866322 AGTATGAACAATTCTGCGTGTGG No data
964090147_964090151 25 Left 964090147 3:152866252-152866274 CCTTAGAAAGGCCCTTTGCATGT No data
Right 964090151 3:152866300-152866322 AGTATGAACAATTCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964090151 Original CRISPR AGTATGAACAATTCTGCGTG TGG Intergenic