ID: 964090310

View in Genome Browser
Species Human (GRCh38)
Location 3:152868540-152868562
Sequence CAGAAGGGCTGGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964090310_964090320 6 Left 964090310 3:152868540-152868562 CCCACATCCCTCCAGCCCTTCTG No data
Right 964090320 3:152868569-152868591 CCAGCTGACTCTCAACCCCAAGG No data
964090310_964090324 26 Left 964090310 3:152868540-152868562 CCCACATCCCTCCAGCCCTTCTG No data
Right 964090324 3:152868589-152868611 AGGTTCTCATTTCTCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964090310 Original CRISPR CAGAAGGGCTGGAGGGATGT GGG (reversed) Intergenic
No off target data available for this crispr