ID: 964092651

View in Genome Browser
Species Human (GRCh38)
Location 3:152894481-152894503
Sequence CTCGTATGACAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964092651_964092656 15 Left 964092651 3:152894481-152894503 CCTTGCCCCTTCTGTCATACGAG No data
Right 964092656 3:152894519-152894541 CAGCCATCTATCTATGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964092651 Original CRISPR CTCGTATGACAGAAGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr