ID: 964092830

View in Genome Browser
Species Human (GRCh38)
Location 3:152896111-152896133
Sequence ACCTAAGTTTTTAGGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964092828_964092830 -1 Left 964092828 3:152896089-152896111 CCAGGCGGTAGTGGAGACAGATA No data
Right 964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG No data
964092827_964092830 7 Left 964092827 3:152896081-152896103 CCTCTGAGCCAGGCGGTAGTGGA No data
Right 964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG No data
964092824_964092830 12 Left 964092824 3:152896076-152896098 CCCTTCCTCTGAGCCAGGCGGTA No data
Right 964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG No data
964092825_964092830 11 Left 964092825 3:152896077-152896099 CCTTCCTCTGAGCCAGGCGGTAG No data
Right 964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964092830 Original CRISPR ACCTAAGTTTTTAGGTAAGA AGG Intergenic
No off target data available for this crispr