ID: 964095680

View in Genome Browser
Species Human (GRCh38)
Location 3:152928589-152928611
Sequence GTAGTTTTACTATATAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964095677_964095680 0 Left 964095677 3:152928566-152928588 CCATCCATAAAAAGCATTTGTTT No data
Right 964095680 3:152928589-152928611 GTAGTTTTACTATATAAAACGGG No data
964095678_964095680 -4 Left 964095678 3:152928570-152928592 CCATAAAAAGCATTTGTTTGTAG No data
Right 964095680 3:152928589-152928611 GTAGTTTTACTATATAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964095680 Original CRISPR GTAGTTTTACTATATAAAAC GGG Intergenic
No off target data available for this crispr