ID: 964098434

View in Genome Browser
Species Human (GRCh38)
Location 3:152961176-152961198
Sequence TCTTACCTGCAGAATGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964098434_964098436 25 Left 964098434 3:152961176-152961198 CCCTGTACATTCTGCAGGTAAGA No data
Right 964098436 3:152961224-152961246 TTGTATTGTTTCTGTCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964098434 Original CRISPR TCTTACCTGCAGAATGTACA GGG (reversed) Intergenic
No off target data available for this crispr