ID: 964106468

View in Genome Browser
Species Human (GRCh38)
Location 3:153045578-153045600
Sequence GTCTTTCAGGGAATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964106459_964106468 27 Left 964106459 3:153045528-153045550 CCATGGCAAGTTTGAATTTTTGT No data
Right 964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG No data
964106463_964106468 -6 Left 964106463 3:153045561-153045583 CCATTCTTGGCTAAGTGGTCTTT No data
Right 964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG No data
964106458_964106468 28 Left 964106458 3:153045527-153045549 CCCATGGCAAGTTTGAATTTTTG No data
Right 964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG No data
964106462_964106468 -3 Left 964106462 3:153045558-153045580 CCACCATTCTTGGCTAAGTGGTC No data
Right 964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964106468 Original CRISPR GTCTTTCAGGGAATGGAGGA AGG Intergenic
No off target data available for this crispr