ID: 964113868

View in Genome Browser
Species Human (GRCh38)
Location 3:153114955-153114977
Sequence AGGGAATATACTAGCTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964113865_964113868 11 Left 964113865 3:153114921-153114943 CCAGATGTGAGAAAATAGCAGAA No data
Right 964113868 3:153114955-153114977 AGGGAATATACTAGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964113868 Original CRISPR AGGGAATATACTAGCTGTTT TGG Intergenic
No off target data available for this crispr