ID: 964115259

View in Genome Browser
Species Human (GRCh38)
Location 3:153130172-153130194
Sequence TTAAGTTTATTAAAGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964115256_964115259 5 Left 964115256 3:153130144-153130166 CCACTGCACCCAGCTGGAAATTC 0: 2
1: 11
2: 78
3: 485
4: 2568
Right 964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG No data
964115257_964115259 -3 Left 964115257 3:153130152-153130174 CCCAGCTGGAAATTCTTTTTTTA No data
Right 964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG No data
964115258_964115259 -4 Left 964115258 3:153130153-153130175 CCAGCTGGAAATTCTTTTTTTAA No data
Right 964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964115259 Original CRISPR TTAAGTTTATTAAAGTGTCT TGG Intergenic
No off target data available for this crispr