ID: 964116082

View in Genome Browser
Species Human (GRCh38)
Location 3:153137689-153137711
Sequence CTTCACATGGCAAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964116082_964116087 22 Left 964116082 3:153137689-153137711 CCTTCCCCATTTGCCATGTGAAG No data
Right 964116087 3:153137734-153137756 TCTTTCACCAATATTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964116082 Original CRISPR CTTCACATGGCAAATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr