ID: 964117273

View in Genome Browser
Species Human (GRCh38)
Location 3:153149320-153149342
Sequence GTGCTGTTCGTGAGGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964117273_964117280 22 Left 964117273 3:153149320-153149342 CCTTAATTCCTCACGAACAGCAC No data
Right 964117280 3:153149365-153149387 CTTTCCCTGACCAGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964117273 Original CRISPR GTGCTGTTCGTGAGGAATTA AGG (reversed) Intergenic
No off target data available for this crispr