ID: 964122571

View in Genome Browser
Species Human (GRCh38)
Location 3:153201068-153201090
Sequence GAGCCTTATCACCTTTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964122564_964122571 0 Left 964122564 3:153201045-153201067 CCAATACTCTATGACCTCACATG No data
Right 964122571 3:153201068-153201090 GAGCCTTATCACCTTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964122571 Original CRISPR GAGCCTTATCACCTTTAGGG GGG Intergenic
No off target data available for this crispr