ID: 964129678

View in Genome Browser
Species Human (GRCh38)
Location 3:153272821-153272843
Sequence CCTGAGAAGCATACAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964129671_964129678 20 Left 964129671 3:153272778-153272800 CCAAGCTAGAATTAGATATGCAA No data
Right 964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964129678 Original CRISPR CCTGAGAAGCATACAGGGGA AGG Intergenic
No off target data available for this crispr