ID: 964130249

View in Genome Browser
Species Human (GRCh38)
Location 3:153279009-153279031
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964130249_964130254 -2 Left 964130249 3:153279009-153279031 CCCTCCTCCCTCTCTTGAAACTG No data
Right 964130254 3:153279030-153279052 TGTTTTTTTCTCTGCACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964130249 Original CRISPR CAGTTTCAAGAGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr