ID: 964134149

View in Genome Browser
Species Human (GRCh38)
Location 3:153325620-153325642
Sequence TACTGCCCAAAGCAACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964134149_964134152 20 Left 964134149 3:153325620-153325642 CCTGCAAGTTGCTTTGGGCAGTA No data
Right 964134152 3:153325663-153325685 ATTATTCCTGCCCATGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964134149 Original CRISPR TACTGCCCAAAGCAACTTGC AGG (reversed) Intergenic
No off target data available for this crispr