ID: 964137106

View in Genome Browser
Species Human (GRCh38)
Location 3:153356395-153356417
Sequence CTCTAGGAGTAATAGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964137106_964137109 28 Left 964137106 3:153356395-153356417 CCCTTTTGCTATTACTCCTAGAG No data
Right 964137109 3:153356446-153356468 TCTGCAACAATGAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964137106 Original CRISPR CTCTAGGAGTAATAGCAAAA GGG (reversed) Intergenic
No off target data available for this crispr