ID: 964137109

View in Genome Browser
Species Human (GRCh38)
Location 3:153356446-153356468
Sequence TCTGCAACAATGAGCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964137106_964137109 28 Left 964137106 3:153356395-153356417 CCCTTTTGCTATTACTCCTAGAG No data
Right 964137109 3:153356446-153356468 TCTGCAACAATGAGCTCTGCAGG No data
964137105_964137109 29 Left 964137105 3:153356394-153356416 CCCCTTTTGCTATTACTCCTAGA No data
Right 964137109 3:153356446-153356468 TCTGCAACAATGAGCTCTGCAGG No data
964137107_964137109 27 Left 964137107 3:153356396-153356418 CCTTTTGCTATTACTCCTAGAGA No data
Right 964137109 3:153356446-153356468 TCTGCAACAATGAGCTCTGCAGG No data
964137108_964137109 12 Left 964137108 3:153356411-153356433 CCTAGAGACTCACATGAAGAATT No data
Right 964137109 3:153356446-153356468 TCTGCAACAATGAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964137109 Original CRISPR TCTGCAACAATGAGCTCTGC AGG Intergenic
No off target data available for this crispr