ID: 964139992

View in Genome Browser
Species Human (GRCh38)
Location 3:153386733-153386755
Sequence AAAAAGCAAAAATGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964139992_964139994 -8 Left 964139992 3:153386733-153386755 CCTGGCCAACATTTTTGCTTTTT No data
Right 964139994 3:153386748-153386770 TGCTTTTTGAAAGACACTGATGG No data
964139992_964139995 12 Left 964139992 3:153386733-153386755 CCTGGCCAACATTTTTGCTTTTT No data
Right 964139995 3:153386768-153386790 TGGAAATGAAAAAAAATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964139992 Original CRISPR AAAAAGCAAAAATGTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr