ID: 964140097

View in Genome Browser
Species Human (GRCh38)
Location 3:153388129-153388151
Sequence CTGTGATTCTGTAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964140095_964140097 26 Left 964140095 3:153388080-153388102 CCTTTAAAATAAGGAAGTCGAAC No data
Right 964140097 3:153388129-153388151 CTGTGATTCTGTAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964140097 Original CRISPR CTGTGATTCTGTAAGCAAGA AGG Intergenic
No off target data available for this crispr