ID: 964151553

View in Genome Browser
Species Human (GRCh38)
Location 3:153531704-153531726
Sequence GTGCCACTTGGCCACTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964151553_964151557 2 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151557 3:153531729-153531751 AGAGAGAATATGTGCACTTAGGG No data
964151553_964151560 25 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151560 3:153531752-153531774 GAGGCAGAGCACAGTGTTTGTGG No data
964151553_964151559 6 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151559 3:153531733-153531755 AGAATATGTGCACTTAGGGGAGG No data
964151553_964151558 3 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151558 3:153531730-153531752 GAGAGAATATGTGCACTTAGGGG No data
964151553_964151556 1 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151556 3:153531728-153531750 GAGAGAGAATATGTGCACTTAGG No data
964151553_964151561 26 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964151553 Original CRISPR GTGCCACTTGGCCACTGCCA GGG (reversed) Intergenic
No off target data available for this crispr