ID: 964151554

View in Genome Browser
Species Human (GRCh38)
Location 3:153531705-153531727
Sequence TGTGCCACTTGGCCACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964151554_964151559 5 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151559 3:153531733-153531755 AGAATATGTGCACTTAGGGGAGG No data
964151554_964151558 2 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151558 3:153531730-153531752 GAGAGAATATGTGCACTTAGGGG No data
964151554_964151561 25 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data
964151554_964151557 1 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151557 3:153531729-153531751 AGAGAGAATATGTGCACTTAGGG No data
964151554_964151560 24 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151560 3:153531752-153531774 GAGGCAGAGCACAGTGTTTGTGG No data
964151554_964151556 0 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151556 3:153531728-153531750 GAGAGAGAATATGTGCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964151554 Original CRISPR TGTGCCACTTGGCCACTGCC AGG (reversed) Intergenic
No off target data available for this crispr