ID: 964151555

View in Genome Browser
Species Human (GRCh38)
Location 3:153531716-153531738
Sequence TATTCTCTCTCTGTGCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964151555_964151561 14 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data
964151555_964151562 26 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151562 3:153531765-153531787 GTGTTTGTGGGACCTTGTATTGG No data
964151555_964151559 -6 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151559 3:153531733-153531755 AGAATATGTGCACTTAGGGGAGG No data
964151555_964151560 13 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151560 3:153531752-153531774 GAGGCAGAGCACAGTGTTTGTGG No data
964151555_964151558 -9 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151558 3:153531730-153531752 GAGAGAATATGTGCACTTAGGGG No data
964151555_964151557 -10 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151557 3:153531729-153531751 AGAGAGAATATGTGCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964151555 Original CRISPR TATTCTCTCTCTGTGCCACT TGG (reversed) Intergenic
No off target data available for this crispr