ID: 964151561

View in Genome Browser
Species Human (GRCh38)
Location 3:153531753-153531775
Sequence AGGCAGAGCACAGTGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964151555_964151561 14 Left 964151555 3:153531716-153531738 CCAAGTGGCACAGAGAGAGAATA No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data
964151554_964151561 25 Left 964151554 3:153531705-153531727 CCTGGCAGTGGCCAAGTGGCACA No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data
964151553_964151561 26 Left 964151553 3:153531704-153531726 CCCTGGCAGTGGCCAAGTGGCAC No data
Right 964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964151561 Original CRISPR AGGCAGAGCACAGTGTTTGT GGG Intergenic
No off target data available for this crispr