ID: 964152571

View in Genome Browser
Species Human (GRCh38)
Location 3:153545200-153545222
Sequence AGCAATATGTTAAACTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964152571_964152575 15 Left 964152571 3:153545200-153545222 CCTCCTTAGTTTAACATATTGCT No data
Right 964152575 3:153545238-153545260 CTTTTTATAGCTATTGTAAATGG No data
964152571_964152577 27 Left 964152571 3:153545200-153545222 CCTCCTTAGTTTAACATATTGCT No data
Right 964152577 3:153545250-153545272 ATTGTAAATGGGCTTGAAAAAGG No data
964152571_964152576 16 Left 964152571 3:153545200-153545222 CCTCCTTAGTTTAACATATTGCT No data
Right 964152576 3:153545239-153545261 TTTTTATAGCTATTGTAAATGGG 0: 19
1: 282
2: 994
3: 2766
4: 6976

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964152571 Original CRISPR AGCAATATGTTAAACTAAGG AGG (reversed) Intergenic
No off target data available for this crispr