ID: 964153143

View in Genome Browser
Species Human (GRCh38)
Location 3:153552797-153552819
Sequence TTACCTCAGAGGTATCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964153143_964153145 13 Left 964153143 3:153552797-153552819 CCAGCAAGATACCTCTGAGGTAA No data
Right 964153145 3:153552833-153552855 AAATAATTTAGCAGAGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964153143 Original CRISPR TTACCTCAGAGGTATCTTGC TGG (reversed) Intergenic
No off target data available for this crispr