ID: 964153963

View in Genome Browser
Species Human (GRCh38)
Location 3:153562860-153562882
Sequence GAATGGAGGAGGTTGGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964153956_964153963 8 Left 964153956 3:153562829-153562851 CCAGAAGGATTCAATGCAATGTA No data
Right 964153963 3:153562860-153562882 GAATGGAGGAGGTTGGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964153963 Original CRISPR GAATGGAGGAGGTTGGTATA GGG Intergenic
No off target data available for this crispr